ID: 1048281866

View in Genome Browser
Species Human (GRCh38)
Location 8:133111885-133111907
Sequence TCAGGATGACCGAAGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048281866_1048281872 1 Left 1048281866 8:133111885-133111907 CCTCCTGGCTTCGGTCATCCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1048281872 8:133111909-133111931 GGATCAGTTAGTCCACAGGGTGG No data
1048281866_1048281875 28 Left 1048281866 8:133111885-133111907 CCTCCTGGCTTCGGTCATCCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1048281875 8:133111936-133111958 GCCTTGCTTCTCGTTCAGCCGGG No data
1048281866_1048281870 -3 Left 1048281866 8:133111885-133111907 CCTCCTGGCTTCGGTCATCCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1048281870 8:133111905-133111927 TGAAGGATCAGTTAGTCCACAGG No data
1048281866_1048281874 27 Left 1048281866 8:133111885-133111907 CCTCCTGGCTTCGGTCATCCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1048281874 8:133111935-133111957 AGCCTTGCTTCTCGTTCAGCCGG No data
1048281866_1048281871 -2 Left 1048281866 8:133111885-133111907 CCTCCTGGCTTCGGTCATCCTGA 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1048281871 8:133111906-133111928 GAAGGATCAGTTAGTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048281866 Original CRISPR TCAGGATGACCGAAGCCAGG AGG (reversed) Intronic
901936333 1:12629717-12629739 CCAGGATTCCTGAAGCCAGGTGG - Intergenic
902518873 1:17004772-17004794 AGAGGATGGCCGGAGCCAGGCGG - Exonic
905901819 1:41586349-41586371 TCATGATGTCCAAAGTCAGGTGG - Intronic
908305885 1:62815618-62815640 TGAGGATCACTGGAGCCAGGAGG - Intronic
913223517 1:116678598-116678620 TCAGCATCACCCAAGCTAGGAGG - Intergenic
913599678 1:120411070-120411092 TTAGGAAGACCAAAGCCAGATGG + Intergenic
914087700 1:144468546-144468568 TTAGGAAGACCAAAGCCAGATGG - Intergenic
914310911 1:146465659-146465681 TTAGGAAGACCAAAGCCAGATGG + Intergenic
914314266 1:146495056-146495078 TTAGGAAGACCAAAGCCAGATGG - Intergenic
914500082 1:148238325-148238347 TTAGGAAGACCAAAGCCAGATGG + Intergenic
914591193 1:149107487-149107509 TTAGGAAGACCAAAGCCAGATGG - Intergenic
916149128 1:161768794-161768816 GCAGGATGACTGAGGCCAGTTGG - Intronic
916349296 1:163830615-163830637 ACAGTTTAACCGAAGCCAGGTGG + Intergenic
918252772 1:182718463-182718485 TCAGGAAGTGCGATGCCAGGTGG - Intergenic
918579782 1:186112449-186112471 TGAGGATGACCTAAGCCTAGTGG - Intronic
923569968 1:235104517-235104539 TCAGGGTGACTTGAGCCAGGAGG - Intergenic
1070588642 10:77785719-77785741 TCAACATGGCCGAAGCTAGGAGG + Intergenic
1076081767 10:127588788-127588810 TCTGGATGATCTAAGCCAGAGGG + Intergenic
1076332847 10:129683685-129683707 TCATGATGACTTAAGACAGGAGG + Intronic
1085790528 11:79493696-79493718 AGAGGGTGGCCGAAGCCAGGCGG - Intergenic
1088901391 11:114120399-114120421 TCAAGATGAACAAAGCCAGGGGG - Intronic
1090332761 11:125944409-125944431 TCAGGAACACGGAAGTCAGGTGG - Intergenic
1092305437 12:7295935-7295957 GCAGGATGACTGAAAGCAGGGGG - Intergenic
1094208975 12:27870535-27870557 TTAGGATGACCGTAGGCAGAAGG + Intergenic
1095939395 12:47716242-47716264 TCTGTCTGAGCGAAGCCAGGTGG - Intronic
1096480186 12:51934970-51934992 TCAGGATGCAGGAAACCAGGAGG - Intergenic
1100390055 12:94140127-94140149 TGAGGATGACAGCAGCGAGGAGG + Intergenic
1101145758 12:101839102-101839124 TCAGGAGGACCAAGGCAAGGAGG + Intergenic
1101496770 12:105262197-105262219 ACAGGAAGACCCTAGCCAGGAGG - Intronic
1102410160 12:112710427-112710449 TCAGGAGGAGAGAAGTCAGGAGG + Intronic
1104894402 12:132154696-132154718 TCAGGTTGGGCGCAGCCAGGAGG + Intergenic
1110121476 13:71887121-71887143 TCAAAATGACAGAAGCCAGATGG - Intergenic
1112905264 13:104410650-104410672 TCTGGATGACCTAATCCAGATGG + Intergenic
1113926829 13:113946475-113946497 GCAGGAGGACCCAGGCCAGGAGG + Intergenic
1119479505 14:74950817-74950839 GCAGGATGACCCAGGCCTGGGGG - Intronic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1125476292 15:40050184-40050206 TCTGGTTGACCCAAGCCATGTGG - Intergenic
1127273398 15:57421433-57421455 CCAGGATCTCCTAAGCCAGGAGG - Intronic
1132761307 16:1509751-1509773 TCAGGCAGACTGAAGACAGGAGG + Intronic
1133770612 16:8865450-8865472 ACAGGATGATAGAAGGCAGGGGG + Intronic
1135623992 16:23979838-23979860 TAACGAGGACCGAAGGCAGGAGG + Intronic
1140244339 16:73234524-73234546 TCATGATGGCCAAAGCCAGGCGG + Intergenic
1140535754 16:75708065-75708087 TCAGGATAACAGAAGAAAGGGGG + Intronic
1141143010 16:81509597-81509619 TCAGGATGACCAGAGGGAGGCGG - Intronic
1141767756 16:86070094-86070116 TCATGACCACCGAAGCCAGAGGG + Intergenic
1145056211 17:19705687-19705709 GGAGGATCACCTAAGCCAGGAGG - Intronic
1145108588 17:20141427-20141449 TTAGCATGACTGAAGCCTGGGGG - Intronic
1146607159 17:34270654-34270676 TCAGGGTGATCAAAGACAGGAGG + Intronic
1146954394 17:36928679-36928701 TCAGGAAGACACAAGGCAGGTGG + Intergenic
1149646139 17:58243006-58243028 GCAAGATGAGGGAAGCCAGGAGG - Exonic
1153411672 18:4800224-4800246 GGAGGATCACCTAAGCCAGGAGG - Intergenic
1154345908 18:13543351-13543373 TCAGGATGACAGTACCCGGGAGG - Intronic
1157584899 18:48794664-48794686 CCAGGATGATTGAAGGCAGGTGG + Intronic
1159903219 18:74067070-74067092 TCAGGATGATGGGAGTCAGGTGG + Intergenic
1160013699 18:75125429-75125451 TCAGAATGACCAAAGCAGGGCGG - Intergenic
1168058046 19:53874405-53874427 TCAGGATGGCCACAGCCAGTCGG - Exonic
925234195 2:2263674-2263696 TCAGGATGAACTCAGCCAGAGGG - Intronic
925248823 2:2411280-2411302 TAAGGATGACAGAAGCCCTGGGG - Intergenic
925456681 2:4022129-4022151 TCAGGAAGGCCGATGCCAGGTGG + Intergenic
926273629 2:11386972-11386994 TCAGAATGACTGAGTCCAGGTGG + Intergenic
926756565 2:16241283-16241305 TCAATATGAGCAAAGCCAGGTGG - Intergenic
928134538 2:28678369-28678391 TCATGTTGACCGAAGCCAGCTGG - Intergenic
931728269 2:65130803-65130825 GGACGATGACCGAACCCAGGTGG - Intergenic
937869307 2:126776459-126776481 TCAGGCTGACTGAACCCAGGGGG - Intergenic
941231450 2:162916352-162916374 TTAAGATGTCCGAAGCAAGGTGG - Intergenic
942521190 2:176806036-176806058 TCTGCATGGCTGAAGCCAGGTGG + Intergenic
948134158 2:235623462-235623484 TCAGGATGACACAAGCCATCGGG + Intronic
1168753939 20:302767-302789 TCAGAAAGACAGAAGCCAGGAGG + Intergenic
1169713175 20:8587413-8587435 TCATAATGACCCAAGCTAGGGGG + Intronic
1169787247 20:9372162-9372184 TCCTGCTGACAGAAGCCAGGAGG - Intronic
1171937117 20:31285665-31285687 GCAGGATGACTGGAGCCAGCTGG + Intergenic
1172191914 20:33067174-33067196 TCAGGATGAAGTAAGCCAGTTGG - Intronic
1177391519 21:20480011-20480033 TGAGGATGGCTGCAGCCAGGTGG - Intergenic
1180123373 21:45768939-45768961 GCATGATGACCGATGGCAGGAGG + Intronic
1184634047 22:45812101-45812123 TGAGGATGACCAAGCCCAGGAGG - Intronic
951019724 3:17769215-17769237 TGAGAATGACCGGAGGCAGGAGG - Intronic
956778990 3:72589703-72589725 TCAGAATCACCGTACCCAGGGGG + Intergenic
959139511 3:102468994-102469016 TGAGAATGGCCGAAGCCAGCGGG + Exonic
960086738 3:113599284-113599306 GCAGGATGACCCACGCCAGTGGG + Intronic
962309471 3:134314924-134314946 ACAGGATGAATGAAGCAAGGAGG + Intergenic
962751361 3:138436647-138436669 TCAGGATGACCAAAGTCTGTGGG - Intronic
969405603 4:6989510-6989532 GCAGGATGCCTGAGGCCAGGGGG - Intronic
969565958 4:7978276-7978298 TCAGGCTCAGCCAAGCCAGGAGG - Intronic
969917270 4:10502867-10502889 TCAGAGTGACAGAAGCCAAGAGG + Intronic
970744516 4:19279269-19279291 TCATGATGACAGAACCAAGGGGG + Intergenic
986403085 5:7397633-7397655 TTAGGATGTCCGGAGCCAGATGG + Intronic
996479083 5:123952963-123952985 TAAGGAGGAGGGAAGCCAGGTGG + Intergenic
997370232 5:133354934-133354956 TCAGCATGACAGGAGCCAGCAGG - Intronic
997471436 5:134119592-134119614 TGGGGATGCCCCAAGCCAGGGGG + Intronic
999157782 5:149470851-149470873 TCAGGATGTCCGCAGCTGGGAGG + Intergenic
1006167505 6:32073650-32073672 TCACGATGACCACAGACAGGGGG + Intronic
1006984398 6:38167442-38167464 TCTGGAAGATCGAAGCTAGGTGG + Intergenic
1011790971 6:90898243-90898265 TCAAGTTGACAGAAGTCAGGAGG + Intergenic
1013612144 6:111805625-111805647 TCAGGAAGAAGGGAGCCAGGTGG - Intronic
1016306973 6:142694944-142694966 TCAGGCTCACCAAAGCCAAGTGG + Intergenic
1017044354 6:150333581-150333603 TCAGGATGGCAGAAGCCAAATGG - Intergenic
1017686512 6:156918826-156918848 GCAGGATGACTGATGCCAGGAGG + Intronic
1020026521 7:4903720-4903742 GCAGGATGAGTGAAGGCAGGTGG - Intergenic
1022366381 7:29723351-29723373 TCAGGATAAAGGAAACCAGGAGG + Intergenic
1022498687 7:30869081-30869103 GCTGGATGACAGGAGCCAGGAGG - Intronic
1022953665 7:35362395-35362417 GCAGGAAGACCGAAGCCTTGAGG - Intergenic
1023867246 7:44244133-44244155 TGGGGATGACCAGAGCCAGGGGG - Intronic
1025294301 7:57763335-57763357 CCAGGATGAAGGAAGGCAGGGGG + Intergenic
1029653903 7:101911881-101911903 ACAGGATGACTGATGTCAGGAGG - Intronic
1033561366 7:142535490-142535512 CCTGGATAACCCAAGCCAGGTGG + Intergenic
1038195531 8:25363425-25363447 TCAGGATGACACAGGCCACGTGG - Intronic
1039816352 8:41097950-41097972 TCAGTGTGACCCACGCCAGGAGG + Intergenic
1041609358 8:59826592-59826614 GCAGGATGACTGAAAGCAGGGGG - Intergenic
1042221254 8:66477039-66477061 TCAGGATAACTGGAGGCAGGTGG - Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043988603 8:86724027-86724049 TGAGGATGACCGGAGGGAGGAGG + Intronic
1044738790 8:95304669-95304691 TCAGGAAGACAGAAGTTAGGAGG - Intergenic
1048281866 8:133111885-133111907 TCAGGATGACCGAAGCCAGGAGG - Intronic
1050299888 9:4247085-4247107 TCAGGAAGACCAAGGCAAGGAGG - Intronic
1052388749 9:27853700-27853722 TGAGGATCACTTAAGCCAGGAGG - Intergenic
1055975379 9:81949915-81949937 TCAGGATGACCGGAGGCACCAGG - Intergenic
1056232072 9:84557176-84557198 TCAGGATGACAGAAACCAAGGGG + Intergenic
1061805245 9:133134087-133134109 TCAGGTTCCCAGAAGCCAGGGGG - Intronic
1189356991 X:40317546-40317568 GGAGGATCACCTAAGCCAGGAGG - Intergenic
1190221653 X:48515901-48515923 ACAGCAGGACCGCAGCCAGGTGG - Exonic
1192411532 X:70937503-70937525 TCAGGATCACCTGAGCCCGGGGG - Intergenic