ID: 1048282214

View in Genome Browser
Species Human (GRCh38)
Location 8:133113999-133114021
Sequence CCTGATGGGCAGCCAAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 153}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048282214_1048282220 0 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282220 8:133114022-133114044 CACACGTGAGCGCATTTAAAGGG No data
1048282214_1048282222 15 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282222 8:133114037-133114059 TTAAAGGGTAGGTGACACACAGG No data
1048282214_1048282226 28 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282226 8:133114050-133114072 GACACACAGGGCCCATAGTGGGG No data
1048282214_1048282219 -1 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282219 8:133114021-133114043 GCACACGTGAGCGCATTTAAAGG No data
1048282214_1048282223 16 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282223 8:133114038-133114060 TAAAGGGTAGGTGACACACAGGG No data
1048282214_1048282224 26 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282224 8:133114048-133114070 GTGACACACAGGGCCCATAGTGG No data
1048282214_1048282221 4 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282221 8:133114026-133114048 CGTGAGCGCATTTAAAGGGTAGG No data
1048282214_1048282225 27 Left 1048282214 8:133113999-133114021 CCCAGTCTTGGCTGCCCATCAGG 0: 1
1: 0
2: 0
3: 19
4: 153
Right 1048282225 8:133114049-133114071 TGACACACAGGGCCCATAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048282214 Original CRISPR CCTGATGGGCAGCCAAGACT GGG (reversed) Intronic
900167653 1:1249962-1249984 CCTGTTTGGCAGCCAAGGCAGGG + Intergenic
900313982 1:2048101-2048123 CCTGATGGGCAGGAAAGAGCAGG - Intergenic
902553595 1:17233745-17233767 CCAGATGGTCAGCCAGGGCTTGG - Intronic
903810080 1:26030472-26030494 CCTGGAGGGCAGCCAGGACCTGG - Exonic
907267929 1:53274154-53274176 CCTGATGGGGAGACCAGACTTGG - Intronic
910303695 1:85737466-85737488 TCTGAAGGACAGCCAAGATTTGG + Exonic
914350050 1:146832797-146832819 CCTGGTGGGCCGCCAAGCCAAGG + Intergenic
916896156 1:169164184-169164206 TCTGATGTGCAACCAAGGCTAGG + Intronic
918037842 1:180893139-180893161 CCTGCTTGGCAGACAAGACTAGG + Intergenic
919733564 1:200930011-200930033 CCAGATGGGGAGCCATGACAGGG + Intergenic
919814989 1:201431568-201431590 CCTGATGAGCAGCAAAGAGATGG - Intergenic
922717399 1:227884685-227884707 CCAGATGGGCAGCCCAGCCCAGG - Intergenic
922975719 1:229781818-229781840 TCTCATGGGCAGCCAAGTCAAGG - Intergenic
1062963386 10:1590123-1590145 CCACATGGGCACCCAAGACATGG - Intronic
1063087180 10:2830509-2830531 CCTGATGGGCAACAAACACGAGG + Intergenic
1064350794 10:14574537-14574559 TCTGATGGGCTGCCAAGAGGTGG - Intronic
1066523203 10:36245999-36246021 TCTGATGTGCAGCAAAAACTAGG + Intergenic
1067466301 10:46501780-46501802 CTGGATGGGGAGCCAGGACTCGG - Intergenic
1067620887 10:47882825-47882847 CTGGATGGGGAGCCAGGACTCGG + Intergenic
1067706185 10:48607981-48608003 CCTAATGTGCAGCCAAGGTTAGG - Intronic
1067836114 10:49642830-49642852 CCTGAAGGCCAGCCAAGCCGGGG - Intronic
1075295545 10:121271962-121271984 TCTGATGGGCAGCCCAGTTTGGG - Intergenic
1075799935 10:125147320-125147342 CCTGATGGGCAGCCAGGGTGGGG - Intronic
1076539925 10:131207358-131207380 CCTCCTGGGCAGCAAAGCCTCGG - Intronic
1076596397 10:131625284-131625306 CCTGAGGGGCAGCGAGGGCTGGG - Intergenic
1078329474 11:10407955-10407977 CTTGGAGGGCAGCCAAGAGTGGG - Intronic
1078421047 11:11213267-11213289 CCTGAGAGCCAGGCAAGACTTGG + Intergenic
1078634376 11:13035164-13035186 CCTGCTGGGCAGCAAAGAGGAGG + Intergenic
1078720136 11:13876666-13876688 CCTGGAGGGCAGCCAAAATTTGG - Intergenic
1079031137 11:16987275-16987297 CCTGGTGGCCAGCCAAGGCCTGG + Intronic
1084212598 11:67630793-67630815 CCAGAGGGGAAGACAAGACTGGG - Intergenic
1085032253 11:73279890-73279912 TCTGATGGGCAGCCAGGGTTGGG + Intronic
1087068177 11:94047097-94047119 CCTGGAGTGCAGCCAAGATTTGG + Intronic
1087083622 11:94195593-94195615 TCTGCTGGGCAGTCCAGACTGGG - Intergenic
1088565480 11:111167934-111167956 CATGATGGGAAGCCATGAATAGG + Intergenic
1090632674 11:128663978-128664000 CCTGATTTACAGCCAAGTCTTGG + Intergenic
1092280366 12:7093234-7093256 CCTGATGGACAGGAGAGACTAGG - Intronic
1096255670 12:50060623-50060645 CCTCCAGGGCAGCCATGACTGGG - Intronic
1096752362 12:53769155-53769177 TCTGATTGGCAGCCAAGTCTGGG + Intergenic
1098594515 12:72256219-72256241 AATAATGGGGAGCCAAGACTGGG - Intronic
1101503345 12:105324968-105324990 CATGTTGGGCAGACATGACTAGG - Intronic
1101877077 12:108603205-108603227 CCTGGTGGGCAGCCATGGCTAGG + Intergenic
1103561782 12:121796642-121796664 GCTCATGGGCAGCCAAGGCCTGG - Intronic
1104080159 12:125422995-125423017 ACTGATGGGCATCCAGGATTGGG - Intronic
1104430629 12:128713203-128713225 CCTGATGAACAGCCCAGGCTTGG - Intergenic
1107853321 13:44591642-44591664 CCTGATCCACAGCCAAGACTTGG - Intergenic
1112310679 13:98315017-98315039 CCTGTTGGCCATCCATGACTTGG - Intronic
1113200335 13:107860425-107860447 TCTGATGTGCAGCCAAGGTTGGG - Intronic
1114429612 14:22649196-22649218 TCTCATGGGCATCCAAGAGTAGG - Intergenic
1120477777 14:85009771-85009793 TCTGTTTGGCAGCCAAGTCTAGG + Intergenic
1122641838 14:103164613-103164635 CCTGATGGGCAGTCAGGAACTGG - Intergenic
1128799836 15:70490396-70490418 CCTGATGGGCAGCTTGGGCTGGG - Intergenic
1130171159 15:81516093-81516115 CCTGATGAGCAGCCAGGTTTAGG + Intergenic
1130295673 15:82646244-82646266 CCTGAGGGGCAGCCAAGAGGCGG + Intronic
1131233649 15:90677950-90677972 TCTGTTGAGCAGCCAGGACTGGG + Intergenic
1132305226 15:100807331-100807353 CCTGGTCAGCAGCCATGACTTGG - Intergenic
1132403571 15:101528741-101528763 CCTGAAGGACAGCCCAGCCTGGG - Intergenic
1133106781 16:3516390-3516412 CCTGCTGGGCAGCCCAGCCTAGG + Intronic
1133787772 16:8986373-8986395 GCTGATGGGATGCCAAGCCTGGG + Intergenic
1139956159 16:70693984-70694006 TCTGCTGGGCAGCCAGGCCTAGG - Intronic
1139983989 16:70882734-70882756 CCTGGTGGGCCGCCAAGCCAAGG - Exonic
1141206060 16:81933956-81933978 CCTGATGGGCAGTCAGAGCTGGG + Intronic
1143472848 17:7186723-7186745 CCTGAAGGACAACAAAGACTGGG - Intergenic
1144806498 17:17971776-17971798 CTTGATGGGCAGGGAAGCCTGGG + Intronic
1145889040 17:28402158-28402180 GCTGATGGGCAGCCATGGCTGGG - Exonic
1145998651 17:29118536-29118558 GATGATGGGCAGACAAAACTTGG - Intronic
1147554017 17:41464833-41464855 CCTCTTTGGCAGCCAAGCCTGGG - Intronic
1148165860 17:45483567-45483589 CCTGATGCTCAGCCAGGAGTTGG - Intronic
1148744660 17:49911602-49911624 CCTAATGGGCAGCCAGGTATGGG + Intergenic
1149452612 17:56761567-56761589 CCAGAAGGGCAGCTATGACTGGG - Intergenic
1150397083 17:64830281-64830303 CCTGATGCTCAGCCAGGAGTTGG - Intergenic
1151505336 17:74523513-74523535 CCTAAGGGGAAGCCAAGCCTGGG - Intronic
1151682567 17:75629604-75629626 CCTGGTGGGGAGCCAGGCCTTGG + Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152657091 17:81524771-81524793 CCTGCTGGGCAGCCCTGAGTAGG + Intergenic
1152807979 17:82366209-82366231 CCTCATGAGGAGCAAAGACTGGG - Intergenic
1152814746 17:82400890-82400912 CCTGATGAGCAGACAAAATTCGG + Intronic
1153003133 18:474442-474464 ACTGATGGGCAGGAAAGACAAGG + Intronic
1154497143 18:14970207-14970229 TCTGAAGTGCAGCCAAGACCGGG - Intergenic
1155445939 18:25913010-25913032 CCTAATGAGCAGCCAAAATTGGG - Intergenic
1157342575 18:46792308-46792330 ACTGATGTGCAGCCAGGGCTGGG + Intergenic
1157433433 18:47649792-47649814 CCCGTTGGGCAGCCAGGAGTGGG - Intergenic
1157762873 18:50276936-50276958 CTTCAAGGCCAGCCAAGACTCGG - Exonic
1158398164 18:57095906-57095928 CCTGAAGGGCATCCCAGCCTGGG - Intergenic
1161452445 19:4354103-4354125 CATGCTGGGCAGCCGCGACTTGG + Exonic
1162935233 19:13978675-13978697 CCTGGTGGGCGGCCCAGACTGGG + Intronic
1166503435 19:43356957-43356979 CCTGAAGGGCCTCCAGGACTAGG + Intronic
1166507019 19:43377804-43377826 CCTGAAGGGCCTCCAGGACTAGG - Intergenic
1167749333 19:51370508-51370530 CCTGAGGGGCAGCCAGGAGCAGG - Intergenic
926715417 2:15920183-15920205 ACTGTTGGGCACCCAGGACTTGG - Intergenic
926785710 2:16516615-16516637 TCTGATGTGCAGCCAAGGTTAGG + Intergenic
928950467 2:36808960-36808982 TCAGATGGGCAGCCATGGCTGGG - Exonic
929124673 2:38512402-38512424 GCTGTTGGGCAGCAAAGGCTGGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
932865205 2:75334450-75334472 CCTAGTGGGCAGCCAAGATTTGG - Intergenic
933424345 2:82090789-82090811 CATGATGGGCAGTGCAGACTGGG + Intergenic
936648985 2:114404677-114404699 GCTGATGAGCAGGAAAGACTGGG + Intergenic
936689473 2:114869549-114869571 CCTGAAAGGCAGCCAACCCTAGG + Intronic
939239488 2:139539269-139539291 CCTCATTGGCAGCAAATACTGGG - Intergenic
940724543 2:157321392-157321414 CCTGATGAGCAGCCAACCTTAGG - Exonic
940848718 2:158668077-158668099 ACTGAGAGGAAGCCAAGACTTGG - Intronic
942199061 2:173552680-173552702 AATGCTGAGCAGCCAAGACTGGG - Intergenic
945891625 2:215436287-215436309 GCTGATGGCCCGCCAGGACTGGG + Intergenic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
947636492 2:231683089-231683111 CCAGAGGGGCAGCCGAGGCTGGG + Intergenic
948405031 2:237711110-237711132 CCAGATGGGAAACCAAGTCTTGG + Intronic
1169662319 20:7993549-7993571 CCTGATGGGTAGCCAAGGACTGG + Intronic
1171425906 20:25048524-25048546 TCTGATGTGCAGCCAGGGCTGGG + Intronic
1173701607 20:45076715-45076737 TCAGATGGGGAGCCATGACTGGG + Exonic
1175916808 20:62429813-62429835 CCTGGTGGGCAGCCAGGAAATGG - Intergenic
1179245053 21:39625796-39625818 CTTGAAGGGAAGCCAAGACTAGG - Intronic
1179262998 21:39775105-39775127 TCTAATGGGCAGCCAGGATTGGG + Intronic
1179317828 21:40260639-40260661 GCTGATGGACAGGCAAGGCTTGG - Intronic
1180676986 22:17593501-17593523 CCTGTTGGACAGCCGAGCCTTGG - Intronic
1181719438 22:24762666-24762688 CCAGATGGGCTGCCCAGTCTTGG - Intronic
1185342657 22:50298556-50298578 CCCGCAGTGCAGCCAAGACTTGG - Intronic
951503921 3:23419980-23420002 ACTGGTGGGCTGCTAAGACTAGG + Intronic
953794586 3:45974792-45974814 ACTGGTGGGTAGCCAGGACTGGG - Intronic
954099459 3:48358125-48358147 CTTGATCAGCAGCCACGACTTGG + Intergenic
954465762 3:50653874-50653896 ACAGATGGGAAACCAAGACTCGG + Intergenic
956248625 3:67212475-67212497 CCTACTGGGTAGCCAAGAATCGG - Intergenic
956380059 3:68655666-68655688 CCTCATGGGCTGCCAAGAATGGG - Intergenic
956604476 3:71059220-71059242 CCTGATTGGCAGGCGAGCCTTGG - Intronic
962343983 3:134606543-134606565 CCTGAAGGACAGCCAGGGCTAGG - Intronic
963060333 3:141220335-141220357 CCTGAGGGCCAGCCAAGTTTGGG - Intergenic
963924569 3:150938014-150938036 CTGGATGGGCACCCAAGACTTGG - Intronic
966769254 3:183489382-183489404 CCTGAAAGGCAATCAAGACTTGG + Exonic
967890484 3:194360995-194361017 GCTGGTGGGCTGCCAAGCCTGGG - Exonic
969348100 4:6581763-6581785 CCTGGCGGGCAGCCAGGAGTGGG - Intronic
969691891 4:8708505-8708527 CCTGATCAGCAGCCAGGACCTGG - Intergenic
970934611 4:21554365-21554387 TTTGATGGGGAGCCAAGACTGGG + Intronic
980088941 4:128421394-128421416 ACTGATGGACAGTCAAGATTTGG - Intergenic
980158568 4:129134066-129134088 CCTGATGTGCTGCCAAGGATGGG + Intergenic
981478736 4:145214032-145214054 ACTGATGTGCAAGCAAGACTTGG - Intergenic
984375337 4:178922354-178922376 GTCCATGGGCAGCCAAGACTGGG - Intergenic
985069576 4:186154900-186154922 CCTTTTGGGCAGCCAGGGCTGGG - Intronic
994523346 5:100871030-100871052 CATGATAGACAGCCAAGTCTAGG - Intronic
998882925 5:146662426-146662448 TCTGATGTGCAGCCAAGGTTGGG - Intronic
1001117110 5:168948971-168948993 CCTGAAGGGCAGCCAGGTGTGGG - Intronic
1001156088 5:169273479-169273501 TCTAATTTGCAGCCAAGACTGGG - Intronic
1001191201 5:169633157-169633179 TCTGATGGGAGGCCAAGAGTAGG - Intergenic
1001962925 5:175891176-175891198 TCTGATGGGCAGCAAAGTCAGGG + Intergenic
1002600315 5:180350803-180350825 TCTCATGGGAAGCCAGGACTCGG - Intronic
1006046956 6:31306818-31306840 CCTGCTGTGCAGCAAAGCCTGGG - Intronic
1017407388 6:154135003-154135025 TCTGGTGGCCAGCCAAGACGTGG + Intronic
1021264696 7:18505689-18505711 CCTGTTGGAAAGCCAAGAGTGGG - Intronic
1021793970 7:24234720-24234742 TCTAATGGGCAGCCAAGGATGGG - Intergenic
1021958849 7:25852724-25852746 CCTGAAGGGGAGCGGAGACTGGG + Intergenic
1022828367 7:34039846-34039868 CCTGATGAGCTGCCAAGTGTGGG - Intronic
1022977143 7:35569198-35569220 TCTGATGGGTAGACATGACTGGG + Intergenic
1023025835 7:36048966-36048988 TCTGATGTGCAACCAAGTCTGGG - Intergenic
1028583037 7:92426116-92426138 CCTGAAGTGCAGCCCAGACTCGG + Intergenic
1033226961 7:139570167-139570189 GCTCATTTGCAGCCAAGACTTGG + Exonic
1036462925 8:8970149-8970171 TCTGATTGCCAGCCAAGTCTTGG - Intergenic
1036699013 8:10998959-10998981 CCTGATGGGAATCTGAGACTTGG - Intronic
1037732470 8:21539257-21539279 CCTGAATGGTAGCAAAGACTTGG + Intergenic
1037802246 8:22042256-22042278 CCTGATCGGCAGCAAATACTGGG - Intergenic
1048182069 8:132204512-132204534 CCTGATGCCCAGCCAAGGCCAGG - Intronic
1048282214 8:133113999-133114021 CCTGATGGGCAGCCAAGACTGGG - Intronic
1048292397 8:133191051-133191073 CCTGATGGGCCGGCCAGTCTGGG + Exonic
1049262495 8:141646961-141646983 CCTCATGGGCCGGCAAGCCTGGG + Intergenic
1049967920 9:796063-796085 TCTGATGAGCAGACAAGGCTGGG - Intergenic
1051572575 9:18577014-18577036 TCTGATAGGCAGCCAAATCTGGG - Intronic
1051665523 9:19464407-19464429 CCTGACGGGCAGCGAGCACTAGG + Intergenic
1053505803 9:38642372-38642394 CCTCTTGGGCAGCCCAGGCTAGG - Intergenic
1060557267 9:124514440-124514462 CCTGATGGGCAGCCAGGCCAAGG + Intergenic
1061388265 9:130303117-130303139 CCTCCTGGGCAGCCCAGCCTGGG + Intronic
1185933622 X:4230750-4230772 CAGCAGGGGCAGCCAAGACTAGG - Intergenic
1189417944 X:40831572-40831594 CCTGATGGAGACACAAGACTAGG + Intergenic
1189867575 X:45347036-45347058 TCTCATGTGCAGCCAAGAGTGGG + Intergenic
1195157642 X:102140342-102140364 CCTGAAGGGTAGCCAAGAATAGG - Intergenic
1197756339 X:129997891-129997913 ACAGGTGGGCAGCCAAGAGTAGG - Intronic
1201714530 Y:17029761-17029783 CATTGAGGGCAGCCAAGACTAGG - Intergenic