ID: 1048282313

View in Genome Browser
Species Human (GRCh38)
Location 8:133114417-133114439
Sequence CAGTACTAGGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 2, 3: 35, 4: 361}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048282313_1048282318 -7 Left 1048282313 8:133114417-133114439 CCTGCCTCCCTCTCCTAGTACTG 0: 1
1: 1
2: 2
3: 35
4: 361
Right 1048282318 8:133114433-133114455 AGTACTGCATGAGCTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048282313 Original CRISPR CAGTACTAGGAGAGGGAGGC AGG (reversed) Intronic
900231353 1:1560098-1560120 CAATACTGGGAGACCGAGGCAGG - Intronic
900575730 1:3381635-3381657 CAGCACTTTGAGAGTGAGGCGGG - Intronic
900706343 1:4082502-4082524 CTTTACTGGGGGAGGGAGGCTGG + Intergenic
900894591 1:5474380-5474402 CAGTAGAAGGCGAGAGAGGCAGG + Intergenic
901558528 1:10050864-10050886 CAATACTAGAATTGGGAGGCAGG - Intronic
902251387 1:15155960-15155982 GACTCCTAGGAGAGAGAGGCTGG + Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
903916880 1:26771310-26771332 CCTTACCAGGAGAGGGAGGCTGG - Exonic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
908393284 1:63702799-63702821 CTGGAGTGGGAGAGGGAGGCAGG + Intergenic
908532822 1:65049794-65049816 CAATGCTAAGAGAAGGAGGCAGG - Intergenic
908696959 1:66854553-66854575 CAGCACTGGGAGGCGGAGGCAGG + Intronic
909702146 1:78537752-78537774 CAGTACTAAGAGGGGAAGACTGG + Exonic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911317125 1:96369183-96369205 CAGCACTGGGAGACTGAGGCAGG + Intergenic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916056560 1:161072632-161072654 CAGGCCTAGGGAAGGGAGGCAGG + Exonic
916358745 1:163943447-163943469 CAGCACTTTGGGAGGGAGGCAGG + Intergenic
916505487 1:165424804-165424826 CAGTCCTGGGTGAGGAAGGCAGG + Intronic
916506815 1:165435695-165435717 AATGACTAGGAGTGGGAGGCAGG + Intronic
917417516 1:174826047-174826069 CAGGACTATTTGAGGGAGGCAGG - Intronic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918513409 1:185336215-185336237 CCCTACTAGGAGATGGTGGCAGG - Intergenic
919739666 1:200974128-200974150 CAGGACTCGGCGAGGAAGGCAGG + Exonic
920675564 1:208036135-208036157 CAGCACTAGGACTGGGAGGGGGG + Intronic
921719887 1:218459858-218459880 CACTTTTAGGAGAGGAAGGCAGG - Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
924624442 1:245687631-245687653 CAGTAATAGGAGAGGCTGTCCGG - Exonic
1063506979 10:6608473-6608495 CATACCTAGGAGAGGGAGACGGG + Intergenic
1064274557 10:13893960-13893982 GTTTACTAGGAGAGGGAGCCTGG - Intronic
1064325037 10:14341898-14341920 CAGCACTGGGAGACTGAGGCAGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066340949 10:34533266-34533288 CACTACTAGAAGAGGGAGGAAGG + Intronic
1069380533 10:67839680-67839702 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1069565483 10:69460796-69460818 GAGTCTTAGGAGAGGGAGGGCGG + Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1070006599 10:72430537-72430559 ATGTACTAGAAAAGGGAGGCAGG - Intronic
1070363740 10:75716008-75716030 CAGTGCTAGAAGAGGCATGCTGG + Intronic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070805090 10:79266215-79266237 AAGTCTTAGGAGTGGGAGGCAGG + Intronic
1070968887 10:80547554-80547576 CAGTGCTGGGAGCGGGAGGGAGG + Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1073065880 10:100758979-100759001 GAGGACTGGGAGAGTGAGGCAGG + Intronic
1073255619 10:102149154-102149176 TAGTAGGAGGAGAGTGAGGCAGG - Intronic
1075521204 10:123144791-123144813 AATTCCTAGGAGAGGGAGACAGG + Intergenic
1076912603 10:133399243-133399265 CAGAGCTGGGAGTGGGAGGCGGG + Intronic
1077053790 11:580165-580187 CTGTCCTAGGAGAGTGAGTCAGG - Intronic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1077755641 11:5025047-5025069 CAGCACTAGCATAGGGTGGCTGG - Intergenic
1079243496 11:18737156-18737178 CAGAACTTGGCGAGGGTGGCAGG + Intronic
1079279497 11:19074610-19074632 GAGCACTAGAAGAGGGAGACGGG - Intergenic
1081671604 11:44945637-44945659 CAGGACTTGGGGAGGGATGCAGG + Intronic
1081720548 11:45285681-45285703 GGGTAAGAGGAGAGGGAGGCTGG - Intronic
1081808608 11:45903085-45903107 GAGTCCTCGGAGAGGCAGGCAGG - Exonic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1084165951 11:67374762-67374784 CAGCCCTTGGAGAGGGAGGAGGG - Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085396940 11:76211165-76211187 CAGGACTAGGACACGAAGGCAGG - Intergenic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088797288 11:113274450-113274472 CAGTTCCAGGAAAGGGAGTCGGG - Intronic
1089014550 11:115155615-115155637 AAGTCCTGGGAGAGAGAGGCAGG + Intergenic
1089348778 11:117809391-117809413 CAGTAGTGGGCCAGGGAGGCGGG - Intronic
1089689910 11:120180812-120180834 CTGTCCTGGGAGTGGGAGGCTGG + Intronic
1091209120 11:133841875-133841897 CAGTAGTGGGAGAGGAGGGCTGG - Intronic
1091641563 12:2241065-2241087 CAGTACGAGGTGAGGGGGGTGGG + Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092732458 12:11547375-11547397 CAGCACTCGGAGCGGCAGGCCGG + Intergenic
1093844285 12:23949811-23949833 GAGTCCTAGGAGAGAGAGGAGGG - Intronic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093934639 12:24987817-24987839 CAGTTATAGGGGAGGGAGGTGGG - Intergenic
1094611232 12:31997586-31997608 CAGCACTAGGAGGCCGAGGCGGG - Intergenic
1095581633 12:43806451-43806473 GAGAACTAGGATAGCGAGGCCGG - Intergenic
1097116760 12:56703135-56703157 CAGTACTGGGAGGCAGAGGCAGG + Intergenic
1097886718 12:64736306-64736328 CAGTTCTAGGAGAGAGAACCAGG + Intronic
1100023209 12:90096736-90096758 AAGTAGTAGGACAGGCAGGCAGG + Intergenic
1102922041 12:116798820-116798842 CAGCACTTGGAGGCGGAGGCAGG - Intronic
1103346635 12:120255447-120255469 CAGCACTGGGAGACCGAGGCAGG + Intronic
1103556273 12:121768617-121768639 CAGGACTGGGAGGTGGAGGCTGG - Intronic
1104214821 12:126725424-126725446 CAGGACTAGGAGAGGAGGGGTGG - Intergenic
1106006301 13:25773153-25773175 CACTACTAGGAGAGACAAGCAGG - Intronic
1108319195 13:49271163-49271185 CAGCACTGGGAGACTGAGGCAGG + Intronic
1109760583 13:66822754-66822776 CAGCACTGGGAGGTGGAGGCAGG - Intronic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111951777 13:94713501-94713523 CAGGACTCGGGGAGGGAGGAGGG + Intergenic
1112701873 13:102019371-102019393 CTTCACTAGTAGAGGGAGGCAGG - Intronic
1113536965 13:111075956-111075978 CAGCAGTGGGAGAGGTAGGCTGG + Intergenic
1113717027 13:112517642-112517664 CAGCACTTTGGGAGGGAGGCAGG + Intronic
1114673975 14:24429206-24429228 CAGGAGTAAGAGTGGGAGGCAGG - Exonic
1115090697 14:29571099-29571121 CAGTTCTACTAGAGTGAGGCAGG + Intergenic
1115428384 14:33287605-33287627 AAGTAGTAGGAGAGGGATGCAGG - Intronic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117202651 14:53408365-53408387 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202673 14:53408422-53408444 CAGGAGTGGGGGAGGGAGGCAGG - Intergenic
1118004233 14:61551376-61551398 CCCTCCTAGGAGAGGCAGGCAGG - Intronic
1118508036 14:66436953-66436975 GACTACTAGAAGAGGGAGGGAGG - Intergenic
1121375813 14:93410092-93410114 CACTGCTAGGTGAGGGAGGAAGG - Intronic
1121974405 14:98389651-98389673 GAGTAGTGGGAGAGGGAGGGAGG - Intergenic
1122279180 14:100611061-100611083 GAGGGCTGGGAGAGGGAGGCTGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122733140 14:103816571-103816593 CAGTACTTGGAGGCTGAGGCAGG + Intronic
1122824172 14:104361639-104361661 GATTTCTAGGAGAGTGAGGCCGG - Intergenic
1123062832 14:105601971-105601993 CAGCACTTGCAGGGGGAGGCTGG - Intergenic
1123576780 15:21677517-21677539 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1123613402 15:22119985-22120007 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1124588567 15:31033717-31033739 CAGTTATAGGAGAGAGAGGGTGG - Intronic
1127513055 15:59662493-59662515 CAGTTATAGGAGAGAGATGCTGG - Exonic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1129163420 15:73760821-73760843 CAGTACTTGGAGAGGGAAGTGGG - Intergenic
1131250242 15:90825592-90825614 CAGCACTCGGAGAGGCCGGCCGG + Intergenic
1202985648 15_KI270727v1_random:411762-411784 TCTTACTAGGAGAGGGAGGATGG + Intergenic
1132535045 16:474631-474653 CAGTAGTGGGAGAAGGAGGGAGG - Intronic
1132677143 16:1125509-1125531 CAGGACTGGGAGTGGGAGCCTGG + Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1134148398 16:11786015-11786037 CAGTAGTAGAAGACTGAGGCTGG + Intronic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1135266924 16:21035028-21035050 CAGAAATAAGAGAGGAAGGCTGG + Intronic
1136403434 16:30030535-30030557 CAGGACTTGGGCAGGGAGGCAGG + Exonic
1136720567 16:32316595-32316617 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136725629 16:32354987-32355009 CAGTACTTTGGGAGGGAGGTGGG + Intergenic
1136838947 16:33522877-33522899 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1136843959 16:33561049-33561071 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1139632407 16:68238547-68238569 CAGCACTGGGAGACCGAGGCGGG - Intergenic
1139825489 16:69754049-69754071 CAGCACTGGGAGACCGAGGCGGG - Intronic
1140489755 16:75325257-75325279 CTGTGCTAGGAGAGGAAGTCTGG - Intronic
1140760088 16:78102157-78102179 CAGTGCTTCGGGAGGGAGGCTGG - Intronic
1142272219 16:89096053-89096075 CAGCCCTCGGGGAGGGAGGCAGG - Intronic
1142367456 16:89657606-89657628 CAGCACTCGGAGAGGGAGAAGGG + Exonic
1142414225 16:89932693-89932715 CAGGGCTGGGATAGGGAGGCTGG - Intronic
1203000802 16_KI270728v1_random:162767-162789 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1203005865 16_KI270728v1_random:201175-201197 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1203132404 16_KI270728v1_random:1699172-1699194 CAGTACTTTGGGAGGGAGGTGGG - Intergenic
1203149110 16_KI270728v1_random:1823164-1823186 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1203154124 16_KI270728v1_random:1861348-1861370 CAGTACTTTGGGAGGGAGGCGGG + Intergenic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1146736388 17:35242556-35242578 AATTACTAGGAGAAGGAGGGAGG + Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147340646 17:39751620-39751642 CAGTACTGAGAGAGGGTGACAGG + Intergenic
1147756028 17:42768558-42768580 CAGCACTAGGAGGCTGAGGCAGG + Intergenic
1148180520 17:45601665-45601687 GAGTCCTTGGAGAGGCAGGCAGG + Intergenic
1148268379 17:46244229-46244251 GAGTCCTTGGAGAGGCAGGCAGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148851867 17:50559483-50559505 CAGAACTCGGGGAGGTAGGCGGG + Intergenic
1150746770 17:67823137-67823159 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151246090 17:72796083-72796105 CAGTCCTAGCAAATGGAGGCTGG - Intronic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1151883518 17:76909733-76909755 GAGTAGTGGGAGAAGGAGGCTGG + Intronic
1151979940 17:77502795-77502817 CAGGACTTGGAGAGGGTGGTCGG - Intergenic
1152184260 17:78844281-78844303 CAGTACCAGGGGAGCGATGCAGG - Intergenic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152916156 17:83037221-83037243 CACTACAAGGAGGGGAAGGCAGG + Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157597722 18:48874095-48874117 AATTAGCAGGAGAGGGAGGCAGG + Intergenic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1159056228 18:63467127-63467149 GAGTTCTAGGAGAGGGAGTAGGG + Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1163334246 19:16660913-16660935 CCGTGCAAGGCGAGGGAGGCTGG - Intergenic
1164519641 19:28968796-28968818 CTGTCCTGGGACAGGGAGGCTGG + Intergenic
1164820024 19:31242811-31242833 CAGTTCTAGGAGAGAGAACCTGG + Intergenic
1165010754 19:32844581-32844603 CAGCACTGGGAGACTGAGGCAGG + Intronic
1165074355 19:33272670-33272692 CAGTGCTAGGATAGGGATGTAGG - Intergenic
1165396692 19:35568266-35568288 CAGCACTAGGAGGCTGAGGCGGG + Intergenic
1166228320 19:41411021-41411043 CAGGACTAGGGGCGGGGGGCTGG + Intronic
1167045506 19:47046667-47046689 CGGAACCAGGAGAGGAAGGCTGG + Exonic
1167303246 19:48691884-48691906 CAGCACTTTGAGAGGGTGGCGGG - Intergenic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
924961325 2:37182-37204 CAGCACTTTGAGACGGAGGCGGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
927506916 2:23620756-23620778 CAGAGGTGGGAGAGGGAGGCAGG + Intronic
927508569 2:23630144-23630166 CAGCACCAGGAGTGGGAGCCAGG + Intronic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
929072076 2:38041256-38041278 AAGTAGTAGGAGAGGAGGGCAGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
934320260 2:91965579-91965601 CAGTACCTTGGGAGGGAGGCGGG - Intergenic
934885077 2:98017243-98017265 CAATTCTATGAGAGGGAGGTGGG + Intergenic
935406012 2:102709383-102709405 CAATACTAGGAGGAGGAGGCAGG + Exonic
935868030 2:107413010-107413032 CAATACTAGGAGAAAGAGACGGG + Intergenic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
940435166 2:153644504-153644526 CAGTACTAGTAGAGGGATCTCGG + Intergenic
940440024 2:153703537-153703559 AAGTACTAAGAAAGGAAGGCAGG - Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941256935 2:163243735-163243757 CAGGAGGAAGAGAGGGAGGCAGG + Intergenic
941759663 2:169227927-169227949 CAGTAATAGGAGATGGACCCTGG + Intronic
941880526 2:170476201-170476223 CACTACTTGGAGAGTGGGGCTGG - Intronic
941960481 2:171248498-171248520 CAGTACTGTGTGAGGCAGGCAGG - Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943988117 2:194649288-194649310 CAGTACTAGGAGAGACAGGCAGG - Intergenic
944127053 2:196306033-196306055 TAGTATTAGGAGATGGGGGCAGG + Intronic
944415720 2:199477785-199477807 CAGTCCTAGGAAAGGGAGACAGG + Intergenic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948056286 2:235011190-235011212 GGGTTCTAGGAGAGGGAGGAAGG - Intronic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170488075 20:16840495-16840517 CAGTCCTAGAAGAGAGAAGCTGG + Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1172519281 20:35556791-35556813 CAAGACTAGGAGAGGGGGTCTGG + Intronic
1172633251 20:36393029-36393051 GAGGACTGGGAAAGGGAGGCTGG + Intronic
1172733882 20:37111206-37111228 CAAGAATAGGAGGGGGAGGCTGG + Intronic
1172846766 20:37934293-37934315 CAGTCCTGGGAGAGGCAGACAGG + Intronic
1174194080 20:48760631-48760653 CTGAGCCAGGAGAGGGAGGCTGG + Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1178016697 21:28355055-28355077 CTGTACTAGGAGAGAGAGAGGGG + Intergenic
1178460676 21:32799441-32799463 CAGGACTTGGAGAGGTAAGCAGG - Intronic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1179949543 21:44702077-44702099 CGTTCCTATGAGAGGGAGGCAGG + Intronic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1180242060 21:46515782-46515804 CAGCACTTTGGGAGGGAGGCCGG - Intronic
1180308508 22:11149624-11149646 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1180546985 22:16511437-16511459 CAGTACTTTGGGAGGGAGGCGGG - Intergenic
1181043391 22:20203473-20203495 CAGTGCTGGGAGGTGGAGGCTGG + Intergenic
1181344011 22:22203832-22203854 CTGAACTACTAGAGGGAGGCTGG + Intergenic
1181386668 22:22550853-22550875 CAGCACTCCCAGAGGGAGGCAGG + Exonic
1181622589 22:24101136-24101158 CAGCAGTGGGAGAGGGAGCCAGG + Intronic
1181886878 22:26028548-26028570 GAGTGCTAGGAGAGGGAGGAAGG - Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
949337428 3:2991260-2991282 CAGTACAAAAAGAGGAAGGCAGG + Intronic
949833985 3:8248153-8248175 CAGTACTATGAGAAGGATGAAGG - Intergenic
949874700 3:8618580-8618602 CAGGCCTAGTTGAGGGAGGCTGG - Intergenic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950934048 3:16820947-16820969 CAGCACTAGGATAGGAAAGCAGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
952815304 3:37442326-37442348 CAGGACTCTGAGAGGGAGGCGGG + Intergenic
952931391 3:38363796-38363818 CAGTGCTGGGAGTGGGAGTCAGG + Intronic
953258743 3:41316605-41316627 TATTACTAGAAGAGGGAGACAGG + Intronic
954408112 3:50356728-50356750 GGCTACCAGGAGAGGGAGGCAGG - Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957939908 3:86991192-86991214 CTGTGCGAGGACAGGGAGGCGGG + Intergenic
958882331 3:99686954-99686976 CAGCACTTTGGGAGGGAGGCAGG - Intronic
959937123 3:112040752-112040774 CAGTACAAGCAAAGGGAGACTGG + Intronic
962394299 3:135001393-135001415 CAGCCCTGGGAGATGGAGGCAGG - Intronic
962706533 3:138049858-138049880 CTGTTCTGGGAGACGGAGGCAGG - Intergenic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963629565 3:147716174-147716196 TAGTACTAAGAGAAGGAGCCTGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964069521 3:152614727-152614749 CAGTCCTGGGAGACTGAGGCAGG + Intergenic
965736043 3:171822222-171822244 CTGTACTTGGGGAGGTAGGCGGG + Intergenic
966403494 3:179570775-179570797 CAGTAGCAGGAAAGGTAGGCAGG + Intronic
966687687 3:182713874-182713896 GGGTACTACAAGAGGGAGGCGGG + Intergenic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967951845 3:194847397-194847419 CTGTACCAGGAGAGAGTGGCTGG + Intergenic
967956391 3:194880688-194880710 CAGAAGGAGGAGAGAGAGGCAGG + Intergenic
968352958 3:198077284-198077306 CAGTCCTAGGAGAGTGAGAGGGG + Intergenic
968610539 4:1554872-1554894 CAGAACTAGCAGAGCAAGGCTGG - Intergenic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969567927 4:7991113-7991135 TAGTTCTAGGAGAGGGAGTGAGG + Intronic
970724475 4:19027890-19027912 GACTACTAGGGGAGGGAGGGAGG + Intergenic
971286258 4:25292797-25292819 CAGCACTTTGGGAGGGAGGCGGG + Intergenic
972834754 4:42856367-42856389 ATGTACTAGGAAAGGGAGGGTGG + Intergenic
975585345 4:75942713-75942735 CAGCACTTGGAGAGTCAGGCAGG + Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
976588437 4:86824723-86824745 GACTACTAGAAGAGGGAGGGAGG - Intronic
979946830 4:126843292-126843314 CAGCACTGGAAGAGGGAGGGAGG - Intergenic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982816734 4:159895119-159895141 CACTAGTAGGAGAGGAAGACAGG + Intergenic
986693827 5:10334610-10334632 GGGTCCTAGAAGAGGGAGGCAGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
992297654 5:75341779-75341801 CAGTACTAGAAGAGGATGACTGG - Intronic
992441528 5:76801512-76801534 GAGAACTGGGAAAGGGAGGCTGG + Intergenic
992962817 5:81972374-81972396 CACTCCTAGGACAGGGAGGAAGG + Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
993566651 5:89484357-89484379 CATTAGTAGGAGATGCAGGCAGG - Intergenic
994340129 5:98617261-98617283 CAGCACTGGGAGACTGAGGCAGG + Intergenic
994679920 5:102873518-102873540 CAGCACTAGGGAAGGTAGGCTGG - Intronic
995353990 5:111216475-111216497 AACTACTAGAAGAGGGAGGGAGG - Intergenic
997633000 5:135384223-135384245 CACTTCTAGGAGATGGAGGCAGG + Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001335721 5:170795190-170795212 TAGTCCTGGGAGGGGGAGGCAGG - Exonic
1001675284 5:173507259-173507281 CAGTACCCAGAGAGGGAGGCTGG + Intergenic
1002682771 5:180981362-180981384 CACTGCTGGGAGAGGGAGGATGG + Intergenic
1003157512 6:3608857-3608879 TGGTACTAGAAGAGGGAGGAAGG + Intergenic
1004046662 6:12031629-12031651 CAGAACTGGGATAGGGAGACAGG + Intronic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1005732349 6:28710225-28710247 CAGTACTAGGAGAGCTACTCAGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007704131 6:43780885-43780907 AAGGACCAGGGGAGGGAGGCAGG - Intronic
1008290831 6:49713779-49713801 CCGTACTAGGAGGAGGAGGGAGG + Intergenic
1008336753 6:50315549-50315571 CAGTACCAGGGGAGGGAGAGAGG + Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010096332 6:72050603-72050625 CAGTACTAGGAGGACAAGGCAGG - Intronic
1011663093 6:89610894-89610916 CAGTACTAAAATAGGGATGCTGG + Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012685237 6:102238798-102238820 CACTACTAGGAGTCTGAGGCAGG + Intergenic
1014003209 6:116387943-116387965 GAGTACTAGGAAAGGGATACTGG + Intronic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1014416505 6:121190901-121190923 TAGTACTAGGAGAAAGTGGCGGG - Intronic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1017919336 6:158857649-158857671 AAGTACATGGTGAGGGAGGCAGG - Intergenic
1018444517 6:163842918-163842940 CAGCTCTAAGAGAGGGAGGGAGG - Intergenic
1018512889 6:164545049-164545071 TAGTACCATGAGAGGGAGTCAGG + Intergenic
1018725001 6:166605082-166605104 CAGTTCTAGGAGAGGCAAGAGGG - Intronic
1019073870 6:169371245-169371267 AAGTCCTGGGAGAGAGAGGCTGG + Intergenic
1019494755 7:1332514-1332536 CAGCCCTAGGAGAGGGAGCCAGG - Intergenic
1019629582 7:2041187-2041209 CTGTGCTAGGAAGGGGAGGCAGG - Intronic
1020389428 7:7642405-7642427 CAGTACTTTGGGAGGGAGACGGG - Intronic
1020713736 7:11642217-11642239 CATTACTAAGAGTGGGAGGTAGG + Intronic
1021064249 7:16154123-16154145 CATTACAAGGAGTGGGAGGCAGG - Intronic
1023732882 7:43209073-43209095 CAGGGTTAGGAGTGGGAGGCGGG + Intronic
1023934192 7:44727526-44727548 AAGTAATAGGAGATGAAGGCAGG + Intergenic
1026390279 7:69894308-69894330 AAGCACTAGGAGAGAAAGGCAGG - Intronic
1026390423 7:69896054-69896076 CAACACTAGCAGAGGGAGCCAGG - Intronic
1028398306 7:90396757-90396779 TAGTACTGGGAGAGGGAAGGTGG - Intronic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1032585159 7:133139681-133139703 CAGAACTAGGATAGGGGAGCTGG - Intergenic
1033217376 7:139502994-139503016 CAGCACTGGGAGGGCGAGGCAGG + Intergenic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1035835005 8:2740607-2740629 CAGTACTATGATAAGGAGGAAGG - Intergenic
1036099125 8:5757979-5758001 CAGGAGGAAGAGAGGGAGGCGGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1039180121 8:34857649-34857671 CAGCACTTTGAGAGGCAGGCGGG + Intergenic
1039345371 8:36698122-36698144 CACTAGTAGGAGAAAGAGGCGGG + Intergenic
1039785293 8:40829394-40829416 CAGTACTAGAGCAGGGAGTCTGG + Intronic
1040798935 8:51319965-51319987 CAGGACTGGGACAGGGAGCCGGG + Exonic
1041128987 8:54676328-54676350 CAGTAATAGGAGAGGGTAGTAGG + Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1042365103 8:67927216-67927238 CAGCACTGGGAGACCGAGGCGGG + Intergenic
1045294157 8:100859570-100859592 GAGTACGAGGAGAGGCAGGTGGG - Intergenic
1045984215 8:108229666-108229688 CAGTACGGAGAGAGGGAGACAGG + Intronic
1047204916 8:122795354-122795376 CAGGGCTAGGCCAGGGAGGCAGG - Intronic
1047711117 8:127553440-127553462 CAGTAGCAAGAGAGAGAGGCAGG - Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048909656 8:139122918-139122940 GACTACTAGGAGAGGGAGCAAGG - Intergenic
1048971382 8:139646932-139646954 CAGTGTTAGGACAGGGAGCCAGG - Intronic
1049137684 8:140918970-140918992 TTGTACCAGGACAGGGAGGCAGG - Intronic
1049257015 8:141619571-141619593 GGGCACTAGGACAGGGAGGCAGG + Intergenic
1049266809 8:141671936-141671958 CCCTCCCAGGAGAGGGAGGCAGG - Intergenic
1049505502 8:142994293-142994315 CAGGACCAGGAGTGTGAGGCTGG + Intergenic
1049566349 8:143341130-143341152 CAGCACGAGAAGAGGGTGGCGGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050253442 9:3769834-3769856 CAGTCCTAGGAGTGGTAGGTAGG + Intergenic
1051039229 9:12785728-12785750 CACTGCTAGGAGATGGAGGAGGG + Intronic
1052758720 9:32567799-32567821 CAGTCCAAGGAGAGGGAGAGAGG - Exonic
1052873211 9:33528709-33528731 CAGTCCTAGGAGAGCGAGAGGGG - Exonic
1053098184 9:35347408-35347430 CAGTAGTAGCAAAGAGAGGCTGG + Intronic
1053202437 9:36161936-36161958 CAGCACTGGGAGACTGAGGCAGG + Intronic
1053502889 9:38616040-38616062 CAGTCCTAGGAGAGCGAGAGGGG + Intergenic
1055734386 9:79312183-79312205 CAGTGATACAAGAGGGAGGCCGG + Intergenic
1056853829 9:90107987-90108009 CAGGCCTAGGAAAGAGAGGCAGG - Intergenic
1057091649 9:92263582-92263604 CAGGACTAGGTAAGAGAGGCAGG - Intronic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1058729489 9:107836241-107836263 CAGTGCCAGGAGAGTGTGGCTGG - Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060494870 9:124111298-124111320 CAGTACTGGGAGTGGGAAACTGG + Intergenic
1060886883 9:127160715-127160737 CAGTGCTAGGGGCTGGAGGCTGG - Intronic
1060985160 9:127815529-127815551 CAGGCCTCTGAGAGGGAGGCGGG + Exonic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1203655625 Un_KI270752v1:21497-21519 CAGCACTAGGAGGCAGAGGCAGG - Intergenic
1185511232 X:666524-666546 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1185511253 X:666613-666635 CAGGACTGGGAGAGGCAGGAAGG + Intergenic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1187180185 X:16936574-16936596 TGGTAGTAGGAGAGGGAGGTAGG + Intergenic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189070406 X:37857273-37857295 CTGTACTAGGAAAGTGAGGAGGG - Intronic
1189270710 X:39749868-39749890 CACTCCTAGCAGTGGGAGGCTGG - Intergenic
1189289652 X:39876098-39876120 CAGCCCTGGGAGTGGGAGGCTGG - Intergenic
1190602793 X:52109410-52109432 GAATACTAGGACAGGGAGGCAGG - Intergenic
1192840095 X:74846117-74846139 CTGTACTAGTTGAGGGTGGCTGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1193714279 X:84919444-84919466 GACTACTAGAAGAGGGAGGGAGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195693277 X:107646890-107646912 CTGAACTATGTGAGGGAGGCTGG + Intronic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197486690 X:127060197-127060219 CAGCACTTCGAGAGGCAGGCGGG + Intergenic
1198399475 X:136255102-136255124 AGGTACTAGGAGGCGGAGGCAGG + Intronic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic