ID: 1048283041

View in Genome Browser
Species Human (GRCh38)
Location 8:133119473-133119495
Sequence GGGAAGATTTGGTGTCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048283039_1048283041 -8 Left 1048283039 8:133119458-133119480 CCAAGATCAAGGCATGGGAAGAT 0: 1
1: 2
2: 44
3: 353
4: 1207
Right 1048283041 8:133119473-133119495 GGGAAGATTTGGTGTCTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048283041 Original CRISPR GGGAAGATTTGGTGTCTAGT AGG Intronic
No off target data available for this crispr