ID: 1048283600

View in Genome Browser
Species Human (GRCh38)
Location 8:133123645-133123667
Sequence GACACAGATGGGGCTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048283600_1048283608 24 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283608 8:133123692-133123714 TCAGACCCTGTGGCCAGGTTTGG No data
1048283600_1048283607 19 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283607 8:133123687-133123709 AGGACTCAGACCCTGTGGCCAGG No data
1048283600_1048283609 25 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283609 8:133123693-133123715 CAGACCCTGTGGCCAGGTTTGGG No data
1048283600_1048283610 26 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283610 8:133123694-133123716 AGACCCTGTGGCCAGGTTTGGGG No data
1048283600_1048283605 -1 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283605 8:133123667-133123689 CCTCTGCTGCTCATGAACAAAGG No data
1048283600_1048283606 14 Left 1048283600 8:133123645-133123667 CCAGGAAGAGCCCCATCTGTGTC No data
Right 1048283606 8:133123682-133123704 AACAAAGGACTCAGACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048283600 Original CRISPR GACACAGATGGGGCTCTTCC TGG (reversed) Intronic