ID: 1048284471

View in Genome Browser
Species Human (GRCh38)
Location 8:133131025-133131047
Sequence GGTGAGTCATACCCCACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048284471_1048284472 -7 Left 1048284471 8:133131025-133131047 CCGGCAGTGGGGTATGACTCACC No data
Right 1048284472 8:133131041-133131063 ACTCACCTTCCAGAAGCCAAAGG No data
1048284471_1048284477 16 Left 1048284471 8:133131025-133131047 CCGGCAGTGGGGTATGACTCACC No data
Right 1048284477 8:133131064-133131086 CAAAGTCCAGACCTCTCTTTGGG No data
1048284471_1048284476 15 Left 1048284471 8:133131025-133131047 CCGGCAGTGGGGTATGACTCACC No data
Right 1048284476 8:133131063-133131085 GCAAAGTCCAGACCTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048284471 Original CRISPR GGTGAGTCATACCCCACTGC CGG (reversed) Intronic