ID: 1048287905

View in Genome Browser
Species Human (GRCh38)
Location 8:133156372-133156394
Sequence TCTCCCCCATTTCATAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048287903_1048287905 -1 Left 1048287903 8:133156350-133156372 CCTTAAGTGTTAGGTACTATCCT No data
Right 1048287905 8:133156372-133156394 TCTCCCCCATTTCATAGAACAGG No data
1048287901_1048287905 15 Left 1048287901 8:133156334-133156356 CCTGTCTTCACAAGAGCCTTAAG No data
Right 1048287905 8:133156372-133156394 TCTCCCCCATTTCATAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048287905 Original CRISPR TCTCCCCCATTTCATAGAAC AGG Intergenic
No off target data available for this crispr