ID: 1048289209

View in Genome Browser
Species Human (GRCh38)
Location 8:133167283-133167305
Sequence GGCCTTGCCCAGATAATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048289209_1048289210 -5 Left 1048289209 8:133167283-133167305 CCAACTATTATCTGGGCAAGGCC No data
Right 1048289210 8:133167301-133167323 AGGCCTCCATGTGAATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048289209 Original CRISPR GGCCTTGCCCAGATAATAGT TGG (reversed) Intergenic
No off target data available for this crispr