ID: 1048292685

View in Genome Browser
Species Human (GRCh38)
Location 8:133192560-133192582
Sequence AAGTAGGAATGGTTAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048292685_1048292692 16 Left 1048292685 8:133192560-133192582 CCAATTTCTAACCATTCCTACTT 0: 1
1: 0
2: 1
3: 29
4: 280
Right 1048292692 8:133192599-133192621 GTCCTACAGGAGTGCCCAGAAGG No data
1048292685_1048292691 3 Left 1048292685 8:133192560-133192582 CCAATTTCTAACCATTCCTACTT 0: 1
1: 0
2: 1
3: 29
4: 280
Right 1048292691 8:133192586-133192608 GGAAGCTGACTGTGTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048292685 Original CRISPR AAGTAGGAATGGTTAGAAAT TGG (reversed) Intronic
902340670 1:15781626-15781648 AAGTAGAAATGGTGAGATGTGGG - Intronic
907217667 1:52879605-52879627 AAAATGGAATGGTTAGAATTTGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909708151 1:78611670-78611692 GAGTAGGAGTGGTGAGAAAAGGG - Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910864697 1:91777483-91777505 AAATTGGAAAGGTTTGAAATGGG - Intronic
911061606 1:93752534-93752556 AAGTACCAAAGGTTTGAAATAGG + Intronic
914387750 1:147188080-147188102 AAGTAGGAATTTATTGAAATGGG + Intronic
915665885 1:157444806-157444828 AAAGAGGTATGGTTAGAAAGAGG - Intergenic
916247167 1:162700146-162700168 AAGAAGAAATGGTGAGAGATAGG - Intronic
916895684 1:169159564-169159586 CAATAGGAATAGTTAGAGATTGG - Intronic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
918648098 1:186925379-186925401 AACTTGGGATGGATAGAAATAGG - Intronic
919001610 1:191838947-191838969 AAGCAGAAATGGCAAGAAATAGG + Intergenic
920208580 1:204311914-204311936 TAGTAGGAAGGGTAAGAAATGGG - Intronic
920292766 1:204935665-204935687 AAGTAGGAGTGATCCGAAATGGG + Intronic
922912943 1:229232722-229232744 AAGGAGGAATGGATGGATATTGG + Intergenic
923663832 1:235981354-235981376 AAGTTGGCATGCTCAGAAATTGG - Intronic
923860093 1:237884700-237884722 GACTAGGAAAGGTTAGACATGGG + Intronic
924301886 1:242648029-242648051 TAGTAGGTATGGACAGAAATGGG + Intergenic
924869945 1:248031029-248031051 AAGTAGAAATGTTTTTAAATAGG + Intronic
1063473175 10:6305479-6305501 ATGTAGGAATGCCTACAAATTGG - Intergenic
1064790854 10:18956577-18956599 ATGTAGAAATGGATAGAAAAGGG - Intergenic
1065106107 10:22387622-22387644 AATTAGGAATTTTTAGAACTTGG + Intronic
1065449463 10:25841771-25841793 AAGTAGCAAAGTTTAGAATTTGG + Intergenic
1066322875 10:34322841-34322863 AATTAGGAATACTTAGTAATAGG + Intronic
1067404649 10:46010598-46010620 AAGAAGGAAAGGATAAAAATGGG - Exonic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1068800816 10:61137921-61137943 GGGTAGGAGTGGTTAGAAAGAGG - Intergenic
1070694017 10:78548487-78548509 AAGGAGGAATGGATGGAAAGAGG + Intergenic
1071102841 10:82059634-82059656 AAGTAAGAATGATTTGAATTGGG - Intronic
1071571902 10:86701703-86701725 CATCAGGAATGGTTAGAATTTGG + Intronic
1073680169 10:105694630-105694652 AAGGAGGAAGGGTAAGAAAGGGG - Intergenic
1073924768 10:108502807-108502829 CAGTAGGAAAGTTTAGAAGTAGG + Intergenic
1074729832 10:116359079-116359101 AAGTAGGAATTGATAAATATTGG - Intronic
1076263932 10:129094237-129094259 GAGTAGTCATGGTGAGAAATAGG + Intergenic
1077945587 11:6894252-6894274 AAGGTGGAAGGGTTATAAATTGG - Intergenic
1079251033 11:18788162-18788184 TTGTAAGAATGGTTAGAAAAAGG - Intronic
1079564340 11:21863445-21863467 AAATAGGAATGGTGAGAGATGGG + Intergenic
1079614885 11:22479996-22480018 AAGAAGGAGAGGTTAGATATTGG - Intergenic
1080250662 11:30229501-30229523 AAGTAGGAATGGGGAGAATATGG - Intergenic
1080483741 11:32681850-32681872 AAGTAAGAATGCTTAGAAAAAGG + Intronic
1081386467 11:42478861-42478883 AGGTAGGTGTGGTTAGAAAGAGG - Intergenic
1081800316 11:45854374-45854396 AACTAGAAATCTTTAGAAATGGG + Intronic
1082731546 11:56804049-56804071 AATTAGGGATGGTTAAAAAAAGG + Intergenic
1085498913 11:76999588-76999610 AAGTAGGTCTGGTTATAAAAGGG - Intronic
1085866369 11:80299199-80299221 AGCTAGGAAGTGTTAGAAATAGG + Intergenic
1086353220 11:85964931-85964953 AAATAGGAATTTTTAAAAATAGG - Intronic
1086575864 11:88338289-88338311 AAGTAGGAAGAGTTGGAAAACGG - Intergenic
1086889238 11:92237384-92237406 AAGTAGAAACTGTTCGAAATTGG - Intergenic
1087142385 11:94777461-94777483 AAGTAAGAAATGTTAGAATTTGG - Intronic
1087860146 11:103143262-103143284 AAATAGGAATGGATTGTAATTGG + Exonic
1088234320 11:107706202-107706224 AATTAGAAATGGCTAGGAATGGG + Intergenic
1088673951 11:112173269-112173291 AAGTAGCTAGGATTAGAAATGGG - Intronic
1089460957 11:118653224-118653246 AAGGAGGAAATGTCAGAAATGGG + Intronic
1089761484 11:120727708-120727730 AAGTAGAAAAACTTAGAAATGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093163642 12:15779962-15779984 ATGTAAGAATGGTTTGAAACAGG + Intronic
1093199121 12:16165757-16165779 TAGCAGGACTGATTAGAAATGGG + Intergenic
1093509484 12:19909561-19909583 AAGTAGGAAAGGGGAGAGATCGG - Intergenic
1094024224 12:25945453-25945475 ATGAAGCAATGATTAGAAATTGG - Intergenic
1096766667 12:53896610-53896632 AAGTGGGAATGGCAAGGAATGGG - Intergenic
1096814188 12:54191357-54191379 AAGTAGGCGTGCTTAGAAACAGG + Intergenic
1096900712 12:54878104-54878126 AAGTAGATATGGTTATAAAAGGG + Intergenic
1097911110 12:64970293-64970315 AAGCAAAAATGGATAGAAATAGG + Intergenic
1098946571 12:76596179-76596201 AAGAATAAATGGTTAGACATGGG - Intergenic
1099096793 12:78384098-78384120 CAGTAAGAATGGATAGAAAGTGG - Intergenic
1100781700 12:98033671-98033693 TAATAGGCATGGTTAGAATTTGG + Intergenic
1101788520 12:107907775-107907797 AAGTAGGAAAGGAGAAAAATAGG + Intergenic
1104541927 12:129673763-129673785 AAGGAGCAAAGGTTGGAAATTGG - Intronic
1106921660 13:34570614-34570636 AAGTAGGAATGGATTGAGAAGGG + Intergenic
1107287119 13:38806210-38806232 AAGTAGAAAGGGCTAGAAATTGG - Intronic
1107615161 13:42159451-42159473 AAGTAGGAATGCTTATTATTAGG + Intronic
1108343431 13:49519989-49520011 GAGGAGGAAAGGTTAGAAAGTGG + Intronic
1108466641 13:50723180-50723202 CAGTAAGAATTATTAGAAATAGG - Intronic
1109186246 13:59272059-59272081 AAGTAGGAATTGGAAGAATTGGG + Intergenic
1109269300 13:60236617-60236639 AAATGGGAAAGGGTAGAAATTGG - Intergenic
1109376864 13:61506926-61506948 GAGGAGGAATAGTGAGAAATTGG + Intergenic
1110198638 13:72821177-72821199 TGTTAGGAATGGTGAGAAATGGG + Intronic
1111206638 13:85019957-85019979 AAGTAGTCATGGTGAGAAAATGG + Intergenic
1111267491 13:85836472-85836494 AAGTAGGAAAAGATAGAAATGGG + Intergenic
1111919269 13:94393652-94393674 AGGGAGGAATGGGGAGAAATGGG - Intronic
1112808239 13:103186765-103186787 CAGTAGTAAGGGTTAGAAACTGG - Intergenic
1113305019 13:109068329-109068351 AAGTGGGAAAGGTTAGAGAGTGG + Intronic
1116638945 14:47436295-47436317 GTGTAGCAAGGGTTAGAAATAGG + Intronic
1117919925 14:60718982-60719004 AAATAGAAATGGTTAGAATTTGG - Intronic
1118448978 14:65880093-65880115 AAGAAGGAAAGGATAAAAATGGG - Intergenic
1119931063 14:78547456-78547478 AAGTATGAATGCCTGGAAATTGG - Intronic
1120089535 14:80315065-80315087 ACGAAGGAATGGTTGGAAACTGG - Intronic
1124286054 15:28401128-28401150 CAGCAGGAAGGGTTAGAACTAGG + Intergenic
1124296647 15:28510532-28510554 CAGCAGGAAGGGTTAGAACTAGG - Intergenic
1125030618 15:35072269-35072291 AAGTAGGTGTGGTTATAAAAGGG - Intergenic
1125455144 15:39850588-39850610 AAGTAGGTGTGGTTATAAAAGGG + Intronic
1125899528 15:43332008-43332030 AACTTGGAATAGATAGAAATGGG + Intronic
1126330849 15:47529466-47529488 AAGTAGGGATGATAAGAAAAGGG + Intronic
1128043822 15:64599581-64599603 AAGTAAGAATGATCAGAAGTAGG - Intronic
1128593287 15:68921701-68921723 AAGGAGGTGTGGTTAAAAATGGG - Intronic
1132337314 15:101056640-101056662 AAGAAGGAAGGGTGAGAAAATGG + Intronic
1133447878 16:5877773-5877795 ATGGAGAAATGTTTAGAAATAGG + Intergenic
1134888521 16:17817299-17817321 AAATAGGAATGGTCATAAAAAGG + Intergenic
1135519327 16:23161855-23161877 AAGTAGGAAAGGTTTGAATATGG - Intergenic
1136397965 16:30003336-30003358 GAGCAGGAGTGGTAAGAAATTGG + Intronic
1137536355 16:49329766-49329788 AAGGAGGAGTGGTATGAAATGGG - Intergenic
1138437482 16:57012036-57012058 AAATAGGAATGATTCTAAATGGG - Intronic
1139561215 16:67743621-67743643 AAGAAGGAAAGGTGAGAAAATGG - Intronic
1139734204 16:68973244-68973266 AAGAAGGAATAAGTAGAAATAGG - Intronic
1140147217 16:72322905-72322927 AAATAGGAATGGTGAGAGAGTGG + Intergenic
1140467681 16:75195535-75195557 AAGCAGGAATGGATAGAATGGGG + Intergenic
1142437995 16:90075413-90075435 AAGGAAGAATGGGCAGAAATGGG - Exonic
1144205145 17:12974419-12974441 AAATATGAATGCTTAGAAATGGG - Intronic
1145034138 17:19528420-19528442 AAGCTGGAATGGTGAGAACTCGG - Intronic
1145180842 17:20750474-20750496 AAGTAGAATTGGTAAGAAAGTGG - Intergenic
1145304068 17:21662200-21662222 AAGTAAGAATGGTAAGGAATTGG + Intergenic
1147789414 17:43004086-43004108 AAGTAGGATTGGTGAGTAACTGG + Intergenic
1150144239 17:62754371-62754393 ATGTAAGAGTGGTTAGAATTTGG - Intronic
1150721214 17:67615748-67615770 AAGAAGGAACGGGGAGAAATTGG + Intronic
1151119965 17:71782039-71782061 CAGTAGGAATGCTTCAAAATTGG - Intergenic
1152990283 18:357108-357130 AAGAAGGAGTAGCTAGAAATAGG + Intronic
1154127465 18:11704443-11704465 AAGTGGGAATAGTGAGGAATGGG + Intronic
1156298222 18:35811852-35811874 ATGGAAGAATGGTGAGAAATGGG + Intergenic
1156645198 18:39152729-39152751 AAGTAGGAAGCATTAAAAATAGG + Intergenic
1156721427 18:40074694-40074716 AAGGAGGAAAGAGTAGAAATGGG + Intergenic
1156870483 18:41939742-41939764 AAGGAGAAATGGTTAGAAGCAGG - Intergenic
1157064001 18:44325719-44325741 AACTTGGAATTGTTAGAAATTGG - Intergenic
1157064005 18:44325771-44325793 CACTTGGAATTGTTAGAAATTGG - Intergenic
1158780241 18:60640496-60640518 AAGTAAGAATGGATATAAAAGGG + Intergenic
1158819128 18:61137963-61137985 AAATAGGATTGGTTAGCACTTGG + Intergenic
1164397503 19:27878831-27878853 AAGTAGGGAAGGTGAGAAAGAGG + Intergenic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1166959076 19:46487238-46487260 AAGAGGAAATGGTTAGAGATGGG + Intronic
927726431 2:25427272-25427294 AAATAAGAATGTTTATAAATAGG - Intronic
928601673 2:32909603-32909625 ACATAGGAATGGTTAAGAATGGG - Intergenic
928796299 2:35025064-35025086 TAGTAACAATGGTTAGAAAGTGG - Intergenic
929871342 2:45761819-45761841 AAGCAGGAAGGGTGAGAAAGCGG - Intronic
932585746 2:73027306-73027328 AAGTAAAAATGTTTAAAAATAGG + Intronic
933220666 2:79683983-79684005 GAGTAGGAAAGATTAGCAATAGG - Intronic
933228402 2:79777761-79777783 AAATAGTATAGGTTAGAAATTGG - Intronic
933236791 2:79873448-79873470 AAGTAGGAAGTGTTAGTGATAGG + Intronic
935240580 2:101174695-101174717 AAGTAGGAGTGCTTAGAGGTAGG + Intronic
935620169 2:105122793-105122815 AAATATGAATCTTTAGAAATTGG - Intergenic
936975478 2:118216971-118216993 AAGTGGGTATGGTTATAAAAAGG + Intergenic
937401939 2:121591818-121591840 AAATAGGTGTGGTTATAAATGGG - Intronic
938149342 2:128868636-128868658 AAATAGCAGTGGTGAGAAATAGG - Intergenic
938721571 2:134071715-134071737 GAGGAGGAAGGGTGAGAAATGGG - Intergenic
938818909 2:134933527-134933549 AAGTAGGAATGGAAACAAAAAGG + Intronic
940342178 2:152592896-152592918 TAATGGGAATGGTTAGAGATTGG + Intronic
942020422 2:171862491-171862513 AAGTAGGAGTGTTTGGATATGGG - Intronic
942417516 2:175774392-175774414 AAGTAGGTGTGGTCAGAAACGGG + Intergenic
944275091 2:197827295-197827317 AAGTAGGAAGTGGTAGGAATTGG - Intronic
944616674 2:201467340-201467362 AAGAGGGAATGGTCAGCAATTGG - Intronic
944658323 2:201898983-201899005 AAGCATTAGTGGTTAGAAATTGG + Intergenic
945061287 2:205911118-205911140 AAGTAGGAAGTGGTAGAACTGGG + Intergenic
945221354 2:207487798-207487820 GAGTAGGAATGATGAGAAAAGGG - Intergenic
946533441 2:220600307-220600329 AAGTAGAATTGGTTAGTCATAGG + Intergenic
946909294 2:224443937-224443959 AGGAAGGAATGGCTAGAAACTGG - Intergenic
947095543 2:226562638-226562660 GAGTAGAAATGTTTAGACATGGG - Intergenic
947511204 2:230755877-230755899 AAGTAGCAATGGTTCGAGAAGGG - Intronic
948226452 2:236313922-236313944 AAGTAGATGTGGTTAGAACTGGG + Intergenic
1171521626 20:25780018-25780040 AAGTAAGAATGGTAAGGAATTGG + Intronic
1171555215 20:26076033-26076055 AAGTAAGAATGGTAAGGAATTGG - Intergenic
1172378018 20:34461805-34461827 AAGGCAGAATGGTTAGAACTTGG + Intronic
1174654175 20:52156345-52156367 AACAAGGAATGGCTTGAAATGGG + Intronic
1175395884 20:58661287-58661309 AAGTAGGAAAGACTGGAAATCGG - Intronic
1176514639 21:7774800-7774822 AAGAAGGAATATTTAGAAACTGG + Intergenic
1176655429 21:9584942-9584964 TAGTAAGAATGGTAAGGAATTGG + Intergenic
1177726276 21:24972094-24972116 AATTAGGAATGCAAAGAAATGGG + Intergenic
1178648752 21:34405324-34405346 AAGAAGGAATATTTAGAAACTGG + Intronic
1179164904 21:38927723-38927745 AAGTAGGAAGAGTTAGACATGGG - Intergenic
1181802085 22:25354365-25354387 CAGTAACAATGGTTAGAAAGTGG - Intronic
1182945714 22:34319649-34319671 AAGTGGGAAAGGTTAGAGATAGG + Intergenic
1184210068 22:43030269-43030291 CAATAGGAAGGGTTAAAAATGGG - Intergenic
949342381 3:3043981-3044003 CAGTAGGAATGTTTAAAAAGTGG - Intronic
949755488 3:7405601-7405623 AATTAGGTGTGTTTAGAAATAGG + Intronic
950349684 3:12336104-12336126 AATTAGGAAGGGTAAGAAGTGGG + Intronic
953651067 3:44804725-44804747 AAGGAGGAAAAGTGAGAAATGGG - Intronic
954050811 3:47975496-47975518 AAGTAGGAAGGGGAAGAAAAGGG + Intronic
955096318 3:55801689-55801711 AAGTAGGACTGGCTATAATTTGG + Intronic
955508724 3:59658157-59658179 GAGAAGAAATGGTCAGAAATGGG + Intergenic
955510603 3:59676792-59676814 AATTAGGGATGGTTAGAAGCAGG + Intergenic
956343822 3:68255781-68255803 AAGTGGGGATGGTTGGAGATGGG + Intronic
957127213 3:76177363-76177385 AAGTTTGAATAGTTAGAATTAGG - Intronic
957431323 3:80111847-80111869 AAGTAGGAAGGGCTAAAAAAAGG - Intergenic
958788004 3:98620116-98620138 AAGGAGGACTGGTTAGACCTGGG + Intergenic
958892891 3:99800253-99800275 AAGAATAAATGGTTAGAATTTGG + Intergenic
959623939 3:108428428-108428450 AAGTAGGGAGGGGAAGAAATGGG - Intronic
960275734 3:115727155-115727177 AACAAGGAGTGGTTAGAAACTGG + Intergenic
960354355 3:116632705-116632727 AAGTTGAGAGGGTTAGAAATAGG + Intronic
960727268 3:120683139-120683161 AATTACCAATGGTTAAAAATTGG - Intergenic
961672039 3:128540216-128540238 CAGTAGGAATGGAAAGAATTGGG + Intergenic
961769320 3:129237101-129237123 TCTTAGAAATGGTTAGAAATGGG - Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963289020 3:143467797-143467819 AAGTAGGTGTGGTTATAAAAGGG - Intronic
964289662 3:155163379-155163401 GAGTAGGAATGCATACAAATTGG - Intronic
966181342 3:177191583-177191605 AATTAAGTATGGTTAAAAATGGG + Intronic
966705142 3:182905437-182905459 AAGCAGGAAAGGTGAGAAATTGG + Intronic
967180182 3:186896664-186896686 AAGTGGCAATGGTGAGAAATGGG - Intergenic
969555855 4:7909512-7909534 AAGGTGGAATGGGTAGAGATCGG + Intronic
971126879 4:23764028-23764050 AAGTATGAATTGGTAGAAAGTGG - Intronic
972145482 4:36019741-36019763 AGGTAGGAGTGGTGAGAAATAGG + Intronic
973580204 4:52336310-52336332 AATAAGCAATGGTTACAAATGGG + Intergenic
973891861 4:55375576-55375598 AAGCAGGAATGTTGAGAAAAGGG - Intergenic
976521056 4:86027296-86027318 TAGTTGGAATGGTTAAAAAGTGG + Intronic
976903607 4:90208834-90208856 CAGTGGGACTGGTTAGAAACTGG - Intronic
978308630 4:107360987-107361009 AACTAGGATTAGTTATAAATGGG + Intergenic
979831489 4:125310888-125310910 AAGTAGGAGGGGTTAGAGATAGG - Intergenic
980666823 4:135951238-135951260 AAGTAATAATGGTTAAAATTAGG + Intergenic
980861842 4:138508535-138508557 AAGAAGAAATGGTTAGGAAAAGG + Intergenic
981141372 4:141273184-141273206 AAGTGGGTAGGGTTAGAATTGGG + Intergenic
981516715 4:145618417-145618439 GAGTAGATATGGTTATAAATGGG - Exonic
981517385 4:145624698-145624720 AAGAAGGAAAGGATAAAAATGGG - Intronic
982034960 4:151336906-151336928 ATGTAGGAATGTTTAGAATTAGG + Intergenic
982448950 4:155529149-155529171 AAATAAGAATGCTTATAAATAGG - Intergenic
983817959 4:172155834-172155856 AAGTAAGAAAGGTTAGAAAATGG - Intronic
983827200 4:172278152-172278174 AAGTAGAAATGTGGAGAAATGGG - Intronic
987109245 5:14669455-14669477 AACTAGGAATTGTTAGCATTTGG + Intronic
987924163 5:24318285-24318307 CACTGGGAATGGTTAGAAAGTGG - Intergenic
989230245 5:39076980-39077002 AAGGAGGAATAGCTAGCAATTGG - Intergenic
989322546 5:40153417-40153439 AGGAAGGAATGGGGAGAAATTGG + Intergenic
990318463 5:54606944-54606966 AGGTAGGAGTGGTTGTAAATGGG - Intergenic
991452586 5:66768651-66768673 AAGTAGGTATGGCTATAAAAGGG + Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994650990 5:102528134-102528156 AAGTTGCATTGGTTAGGAATCGG - Intergenic
995065085 5:107852451-107852473 AAATAGGACTGGGAAGAAATGGG + Intergenic
995172640 5:109135486-109135508 AAGTCGCAATGGTTACATATTGG + Intronic
996756493 5:126941198-126941220 AAGAAGGTATGTTTAGAATTTGG + Intronic
998110202 5:139495573-139495595 AAGAAGGAAAGGATAAAAATGGG + Intergenic
998304813 5:141063605-141063627 AAGTAGCAATGCATAAAAATTGG + Intergenic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
999917640 5:156280812-156280834 AAGGAAAAATGGGTAGAAATTGG - Intronic
1000444300 5:161301070-161301092 AATTAGGGATAGTTAGCAATTGG + Intronic
1001210093 5:169802858-169802880 GGGTAGGAAGGGTTAGAAAAGGG + Intronic
1003755324 6:9113100-9113122 AAGTGGAAATGTTTACAAATGGG + Intergenic
1003919860 6:10823003-10823025 GAGGGGGAATGGTTAGAAGTTGG - Intronic
1004060317 6:12190163-12190185 TAGTAGGAACGGGAAGAAATGGG + Intergenic
1006215860 6:32442224-32442246 AAGAAGGACTGGTTATAAAGAGG - Intronic
1006395622 6:33785360-33785382 AGGTCTGAATGGTTACAAATAGG + Intronic
1007281886 6:40719064-40719086 AAGTGGGAAAGAATAGAAATTGG + Intergenic
1007993130 6:46278095-46278117 AAGAGGGAATGGATAGAAATGGG - Intronic
1008086187 6:47247150-47247172 AAGGAGCAATGTTTATAAATAGG - Intronic
1010177882 6:73050834-73050856 AAGTAGTAATCTTTTGAAATTGG + Intronic
1011220281 6:85047898-85047920 AAGGAGGAAAGGTTAGAGGTAGG - Intergenic
1011372540 6:86652620-86652642 AAGTAGATATGGTTACAAAAGGG - Intergenic
1013630154 6:111978842-111978864 AAAAGGGAATGGTCAGAAATAGG - Intergenic
1015058270 6:128930246-128930268 CAGTAGGAATGAAAAGAAATAGG - Intronic
1015582418 6:134740322-134740344 AAGTAGGAAATGTCAAAAATTGG - Intergenic
1017179463 6:151536819-151536841 ATGTAGGAGTGATTAGAAATAGG + Intronic
1019684303 7:2372272-2372294 AGGAAGGAAGGGTTAAAAATAGG + Intronic
1020889536 7:13861666-13861688 AAGAAGGAATGGTTACTAAGAGG - Intergenic
1021380306 7:19958229-19958251 AATTAGTAATGCTGAGAAATGGG + Intergenic
1022776807 7:33535168-33535190 AAGTAGTAATGGATAAAAAGAGG - Intronic
1024204581 7:47145976-47145998 AACAGGTAATGGTTAGAAATAGG + Intergenic
1025282074 7:57634792-57634814 AAGTAAGAATGGTAAGGAATCGG + Intergenic
1025302656 7:57830725-57830747 AAGTAAGAATGGTAAGGAATCGG - Intergenic
1027333012 7:77119970-77119992 AAGTATGAAAGGTTAGACATAGG - Intergenic
1027858623 7:83545945-83545967 TGCTAGGAATGTTTAGAAATGGG + Intronic
1028295540 7:89125455-89125477 AAGCAAGAATTGGTAGAAATTGG - Intronic
1029195261 7:98801439-98801461 AACTAGAGATGGTTAGAAAGGGG - Intergenic
1029782774 7:102751326-102751348 AAGTATGAAAGGTTAGACATAGG + Intronic
1031572199 7:123373388-123373410 AAGCAGGGAGGGTTACAAATGGG - Intergenic
1031892021 7:127305736-127305758 TATTAGGAATGATTAGAAAATGG - Intergenic
1032054549 7:128673851-128673873 AAATAGAAATGACTAGAAATTGG - Intronic
1032443750 7:131962337-131962359 GGGTAGAAATGGTTAGAACTAGG - Intergenic
1033426239 7:141246892-141246914 AAGAAGGAATGCTTGGTAATGGG - Intronic
1035725223 8:1820422-1820444 AAGTGGGATTGCTGAGAAATGGG + Intergenic
1038779392 8:30557357-30557379 AAGCAGGGATGTCTAGAAATTGG - Intronic
1039528772 8:38240625-38240647 AATTTGAAATAGTTAGAAATAGG - Intronic
1039838928 8:41279909-41279931 AAATAGGTAGGGTCAGAAATGGG - Intronic
1042650008 8:71029806-71029828 TAGTAAGAATGGTTTAAAATAGG - Intergenic
1043926947 8:86048101-86048123 TAGCAGGAATAGTTAGATATGGG - Intronic
1044268962 8:90217310-90217332 AAGTGAGAATGGTTGGAAATTGG - Intergenic
1046261496 8:111773979-111774001 AAGAAAGAATGGAAAGAAATGGG + Intergenic
1047201092 8:122768366-122768388 AAGTAGGAGTGGCTATAAAAGGG + Intergenic
1047219030 8:122903808-122903830 AAATGGGAATGGTTAGAAATGGG + Intronic
1047260148 8:123249861-123249883 CAGTAAAAATTGTTAGAAATGGG - Exonic
1047393946 8:124476620-124476642 AAGTAGGAAAGGCTGGAATTAGG - Intronic
1048292685 8:133192560-133192582 AAGTAGGAATGGTTAGAAATTGG - Intronic
1048657518 8:136557678-136557700 ATCTATGAATGGTTAGCAATGGG - Intergenic
1048870947 8:138797714-138797736 AACTAGGAATGTGGAGAAATTGG - Intronic
1049942799 9:564628-564650 AAGTAGGCATGGGCAGAAATAGG - Intronic
1050008261 9:1157767-1157789 AAGTAGGAGTGGTGAGAACTGGG + Intergenic
1050754806 9:8989340-8989362 AAGGAGGAATGAAGAGAAATTGG - Intronic
1057455853 9:95209471-95209493 GTGTAGGAATGGGTAGATATGGG + Intronic
1058235096 9:102479993-102480015 AAATATGAAATGTTAGAAATGGG - Intergenic
1058387268 9:104452382-104452404 AGGAGGGAATGGATAGAAATGGG - Intergenic
1058930495 9:109714485-109714507 AAGAAGGAATGGGGTGAAATTGG - Intronic
1059736102 9:117101416-117101438 AAGTGAGAATGGTTAGAGACTGG + Intronic
1060579553 9:124732378-124732400 TAGTCATAATGGTTAGAAATAGG - Intronic
1061274663 9:129562626-129562648 AAGTACAAATGGATAGACATGGG + Intergenic
1203633147 Un_KI270750v1:88414-88436 TAGTAAGAATGGTAAGGAATTGG + Intergenic
1185565256 X:1090348-1090370 AAGTGGGTATGGCTACAAATAGG + Intergenic
1186861521 X:13677292-13677314 ATTTAGGAATGCTTAGAAGTTGG + Intronic
1188271169 X:28142494-28142516 TGGCAGCAATGGTTAGAAATTGG + Intergenic
1188541824 X:31259210-31259232 GAGTAGGAAATGTTAGAAGTGGG + Intronic
1189954976 X:46268675-46268697 AAGTAGGAACGCTTAGATGTGGG - Intergenic
1191663760 X:63677086-63677108 TAGTAGGACAGGTTAGAGATGGG - Intronic
1191975609 X:66867919-66867941 AAGTAGGACTGGCTAGAGCTGGG - Intergenic
1192085693 X:68095029-68095051 AAATAGGAAGGGTTGGAAAGTGG - Intronic
1193084926 X:77440400-77440422 TAGTATAAATGGTTAGAAAATGG + Intergenic
1193843345 X:86437414-86437436 TAGGAGGAATGGATAGAAGTTGG - Intronic
1194179188 X:90692166-90692188 CTGTAGGAATGGTTTGTAATTGG - Intergenic
1194305827 X:92246872-92246894 AAGGAGGAATGGAGAGAAAGAGG + Intronic
1195491481 X:105475462-105475484 AAGTATGAAAGGTTAAACATGGG - Intronic
1196023409 X:111014067-111014089 AAGTGGGAGTGGTTAGCAAAGGG - Intronic
1196236093 X:113282063-113282085 AAGTATGAAAGGTTAGCAACTGG - Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1196990501 X:121323791-121323813 AAGTAGGAATAATTTGAACTTGG + Intergenic
1197031799 X:121825151-121825173 AAATAGGAGTGGTGAGAAAGGGG - Intergenic
1198256326 X:134927002-134927024 AAGGAGTAATGGTTTGAAAGTGG - Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1200907960 Y:8504316-8504338 AAGTAGGATTGAATAGAAGTAGG + Intergenic
1201487316 Y:14507269-14507291 AGGTAGGAATTTTTAGAAGTGGG - Intergenic