ID: 1048293240

View in Genome Browser
Species Human (GRCh38)
Location 8:133196159-133196181
Sequence CACTGTGCCCAGAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048293240_1048293245 6 Left 1048293240 8:133196159-133196181 CCCACTCTACTCTGGGCACAGTG 0: 1
1: 0
2: 4
3: 32
4: 345
Right 1048293245 8:133196188-133196210 TGCACACACCTATGAGGCAGCGG No data
1048293240_1048293243 0 Left 1048293240 8:133196159-133196181 CCCACTCTACTCTGGGCACAGTG 0: 1
1: 0
2: 4
3: 32
4: 345
Right 1048293243 8:133196182-133196204 CCCTTTTGCACACACCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048293240 Original CRISPR CACTGTGCCCAGAGTAGAGT GGG (reversed) Intronic
900437573 1:2638815-2638837 CACTGTGCTCAGGGCAGAGGTGG + Intronic
900785804 1:4649688-4649710 GACTGAGCCCTGAGTAGAGGAGG - Intergenic
901755308 1:11438005-11438027 CACAGTGTCCAGAATATAGTAGG + Intergenic
901961382 1:12828924-12828946 CACTGAGTACAGAGTAGAATTGG - Intronic
901967968 1:12883529-12883551 CACTGAGTACAGAGTAGAATTGG - Intronic
901998718 1:13175124-13175146 CACTGAGTACAGAGTAGAATTGG + Intergenic
902017208 1:13318251-13318273 CACTGAGTACAGAGTAGAATTGG + Intronic
902030116 1:13416195-13416217 CACTGAGTACAGAGTAGAATTGG + Intronic
903024539 1:20418018-20418040 CACAGTGCCCGGTGCAGAGTAGG - Intergenic
903575484 1:24337218-24337240 CACTGTCCCCAGAGCATAGCAGG + Intronic
903976484 1:27153754-27153776 CACTGTGCACAGAAGAGAGCAGG - Intronic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
904711109 1:32431030-32431052 CACTGTGCCCAGCCAAGACTAGG - Intergenic
905408817 1:37754300-37754322 CACCGTGCCCAGAGCACAGCCGG - Exonic
905554018 1:38867700-38867722 CAATGTGCTCAGCGTATAGTTGG - Intronic
905649790 1:39648504-39648526 CATTGGGCCCAGAGTAAAGATGG + Intergenic
905850306 1:41269130-41269152 CACTGAGCTCAGAGTTGAGAAGG + Intergenic
906264189 1:44416576-44416598 CACTCAGCCCAGATTGGAGTTGG + Intronic
906944097 1:50280929-50280951 CAATGTGCCCAGAGCAGACCTGG + Intergenic
907146712 1:52240754-52240776 GAGGGTGCCAAGAGTAGAGTAGG - Intronic
908389924 1:63675197-63675219 CACTGTGCCTGGAGCATAGTGGG + Intergenic
908897641 1:68918403-68918425 TTCTGTATCCAGAGTAGAGTGGG + Intergenic
908986596 1:70031215-70031237 CACAGTGCCTAGGATAGAGTAGG + Intronic
909647059 1:77929603-77929625 AACTGTGCCAAGAGTAGAAATGG + Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910290385 1:85595015-85595037 CATTGTGCCCACAGAAGTGTGGG + Intergenic
911010081 1:93271544-93271566 CACTGCACCCAGCTTAGAGTGGG - Intronic
911419784 1:97626046-97626068 CACTTTGCCCATAGTCTAGTAGG - Intronic
912809899 1:112786139-112786161 CACTGTGCCCAGCCAAGACTGGG + Intergenic
913508714 1:119543051-119543073 CACTTGGCCCAGAGTACAGCAGG - Intergenic
914451683 1:147798372-147798394 CACAGTGCTCAGAGGATAGTTGG - Intergenic
915068915 1:153249429-153249451 CACAGAGCCCAGAGTGGGGTAGG + Intergenic
915296754 1:154926735-154926757 CACAGTGACCAGCGTACAGTAGG - Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
918576374 1:186065615-186065637 CACTGTGCCTAGAACATAGTAGG - Intronic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
919710778 1:200726055-200726077 CACTGTTTCCATAGTATAGTTGG + Intergenic
920357931 1:205389335-205389357 CACTGTGCCCAGCCTACATTTGG + Intronic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922242307 1:223763784-223763806 CACTGTGCCCAGCCTAGATACGG - Intronic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923854889 1:237835671-237835693 CACTGTGCCCAGAGTAAATGAGG - Intergenic
923994569 1:239478329-239478351 CACTGTGTTCAAAGAAGAGTTGG - Intronic
1062942872 10:1438034-1438056 CACTCTGCCCAAAGGAGAGGAGG - Intronic
1063505165 10:6591277-6591299 AGCTGTGCCCAGAGCAGAGAGGG + Intergenic
1065512650 10:26494537-26494559 CACTGTGCCCGGTCTAGAATTGG - Intronic
1066284844 10:33955527-33955549 CCCTGTGGCCAAAGTAGGGTGGG - Intergenic
1066646846 10:37618896-37618918 CACTGTGCCCCAAGTCTAGTTGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068778315 10:60891634-60891656 CACTGTGCCCAGCCTAGAGGAGG + Intronic
1069359901 10:67630225-67630247 CCCTGTGCCCAGAGGACAATGGG - Intronic
1070534159 10:77362565-77362587 CACAGTGCCCAGAGGACAGCAGG + Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1073676589 10:105654321-105654343 CCCTGTTCCCAGAGTAAGGTTGG + Intergenic
1073766324 10:106686569-106686591 AACTGTGCCTTGCGTAGAGTAGG + Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074884865 10:117685551-117685573 GTCTGTGGACAGAGTAGAGTGGG - Intergenic
1075216331 10:120539421-120539443 CACTGTGCCCAGCACACAGTGGG + Intronic
1075602098 10:123777321-123777343 CACTGTGCCCAAACCAAAGTAGG + Intronic
1076508239 10:130993211-130993233 CACAGAGCCCAGATTAGAGTTGG + Intergenic
1076512488 10:131022554-131022576 CATTGTCCCCAGACAAGAGTAGG + Intergenic
1076869229 10:133185243-133185265 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1076869232 10:133185289-133185311 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1076869245 10:133185450-133185472 CAGTGTGTGCAGTGTAGAGTAGG + Intronic
1078453904 11:11460390-11460412 CATTTTGCTCAGAGTAGTGTTGG - Intronic
1078476901 11:11638181-11638203 CACTGTGCTTGGAGCAGAGTGGG + Intergenic
1078559514 11:12358252-12358274 CACTGGGCTCAGAGAAGATTGGG - Intronic
1078575477 11:12498322-12498344 CACTGTGCCCAGCCTAGAACAGG + Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1083227353 11:61293699-61293721 CCCAGTGCCCAGCGCAGAGTGGG - Intronic
1083778750 11:64907291-64907313 CACTGTCACCAGTGTAGAGAAGG + Exonic
1084145783 11:67264673-67264695 CACTCTGCCCAAAGCAGATTAGG - Intergenic
1084643177 11:70437928-70437950 CACCGTGCCCAGCGTAGATGTGG + Intergenic
1084927146 11:72522870-72522892 CACTGTGCCCGGCCGAGAGTTGG + Intergenic
1085584581 11:77689873-77689895 CACTGTGCCCAGCCTGGAGAAGG - Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1086973245 11:93105952-93105974 GACTGTTCCCAGTGTATAGTAGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088297682 11:108318395-108318417 CACTGTGCCCAGCCCTGAGTAGG - Intronic
1088606417 11:111537907-111537929 CACTGTGCCAACAGAAGACTGGG + Intergenic
1090908483 11:131097560-131097582 CACTGTGCCCAGTGCTGAGTTGG + Intergenic
1096421701 12:51464239-51464261 CACAGTGCCCTGAACAGAGTAGG + Intronic
1097174018 12:57132501-57132523 CGCTGAGCCTAGAGTAGGGTGGG - Intronic
1097770930 12:63584368-63584390 CACAGTGCCTAGAATACAGTAGG - Intronic
1100255766 12:92881301-92881323 CACTGCCTCCCGAGTAGAGTAGG - Intronic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1103151150 12:118640133-118640155 CCCTGTGCCCAGAGCAGTTTGGG + Intergenic
1103286739 12:119808675-119808697 GACTGTGCCTAGAATACAGTGGG + Intronic
1104615517 12:130264997-130265019 CAGTGTGCCCAGCAGAGAGTAGG + Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105763536 13:23535061-23535083 CACTGTGTCCCCAGCAGAGTGGG - Intergenic
1106132187 13:26949661-26949683 CACTGTTCCCAGAGAAAAATAGG - Intergenic
1109051699 13:57491532-57491554 CTCAGTGCCCAGAGAAGAGCTGG + Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1118016346 14:61664936-61664958 GACTGTGGGAAGAGTAGAGTAGG - Intergenic
1119499281 14:75109709-75109731 CACTGTGACCACAGCAAAGTGGG + Exonic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1124944861 15:34255340-34255362 CACTGGGCCCAGAGTTTGGTGGG - Exonic
1127633056 15:60843942-60843964 TCCTGTGCCCTGAGCAGAGTAGG - Intronic
1129711618 15:77823139-77823161 CACTCTGCCAAGAGTAAAGAGGG - Intergenic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130214412 15:81954682-81954704 CACTGTGCCCAGAGCATCATAGG - Intergenic
1131021873 15:89105988-89106010 CACTGTGCCCAGCCGAGAGGTGG + Intronic
1131977751 15:97962200-97962222 CACTGTGTCCACAGTAGGATAGG - Intronic
1132993059 16:2807344-2807366 CACTGTGCCCGGCCTAGAGATGG + Intergenic
1134069409 16:11251500-11251522 CACTGTGCCCAGCGCAGGATGGG - Intronic
1134678441 16:16106922-16106944 CACAGTGCCCAGTGCACAGTGGG - Intronic
1135055802 16:19231280-19231302 CACTGTGCCCAGCATACAGAGGG - Intronic
1135056688 16:19237868-19237890 CACTATGGCCAGAGCAGGGTTGG + Intronic
1135304025 16:21353725-21353747 CTCTGTCCCCACAGTAGAGTTGG - Intergenic
1136300759 16:29332862-29332884 CTCTGTCCCCACAGTAGAGTTGG - Intergenic
1136329726 16:29564488-29564510 CACTGGGCCCTGCCTAGAGTGGG - Intergenic
1136444353 16:30304192-30304214 CACTGGGCCCTGCCTAGAGTGGG - Intergenic
1136924763 16:34361917-34361939 CACTGTGCTGATAGAAGAGTTGG - Intergenic
1136925017 16:34363677-34363699 CACTGTGCCCAGCCTTGAGCAGG + Intergenic
1136979556 16:35048129-35048151 CACTGTGCCCAGCCTTGAGCAGG - Intergenic
1136979810 16:35049889-35049911 CACTGTGCTGATAGAAGAGTTGG + Intergenic
1137010495 16:35315818-35315840 CACTGTGTCCACAGGAGGGTAGG - Intergenic
1137237531 16:46627794-46627816 CACTGTGCCCTGAGTAGTTTGGG - Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137636443 16:49991089-49991111 CACTGTGCCCAGCCTAGTGTTGG - Intergenic
1138606026 16:58089230-58089252 CAGTGTGCCCAGAGTAGCCTGGG - Intergenic
1139300987 16:65945333-65945355 TACAGTGCCCATAGCAGAGTTGG + Intergenic
1139694152 16:68661597-68661619 CACTGTGCCCAGTACAAAGTAGG - Intronic
1140656319 16:77143701-77143723 CCTTGTGCCTAGGGTAGAGTTGG - Intergenic
1141220891 16:82068464-82068486 AACAGTGCCCAGAGTGGAGTGGG - Intronic
1141558435 16:84851433-84851455 CCCCGTGCCCTGTGTAGAGTGGG + Intronic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142111075 16:88331989-88332011 CACTGTGCCAAGAGCAGAGCTGG + Intergenic
1142115959 16:88356189-88356211 CTCTGTGCCCAGAGCCGAGGAGG - Intergenic
1142290552 16:89192065-89192087 CATTGTGCCCAGAGGACGGTGGG + Intronic
1142699964 17:1653226-1653248 CACTGTGCCCAGCCGAGTGTTGG + Intronic
1143693242 17:8588739-8588761 CACTGAGCACACAGTACAGTAGG + Intronic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1146121005 17:30194928-30194950 CACTGTCTCCAAATTAGAGTTGG + Exonic
1146666682 17:34709792-34709814 CACAGTGCCTAGAACAGAGTAGG + Intergenic
1146679415 17:34796334-34796356 CACTGTGCCCAGTGGAGGGATGG - Intergenic
1147807499 17:43142200-43142222 CACTGTGCCCAGCCTAGTCTTGG + Intergenic
1148645001 17:49214802-49214824 CACAGTGCCTAGAATACAGTGGG + Intronic
1148711379 17:49683781-49683803 CACAGTGCACAGATAAGAGTGGG - Intergenic
1148781929 17:50127312-50127334 CACTGCGCCCAGCCTAGAGGTGG - Intronic
1148997729 17:51725838-51725860 CACAGTGTCCAGCATAGAGTAGG - Intronic
1149299647 17:55293355-55293377 CACTGTGCTCTGAGGAGAGAAGG + Intronic
1149316314 17:55442252-55442274 CAGTGTGCCCAGAGTAGCTGTGG + Intergenic
1149544028 17:57489730-57489752 CACTGTGCCCAGCACACAGTGGG - Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1151074970 17:71260812-71260834 AACAGTGCCCGGTGTAGAGTAGG + Intergenic
1152094910 17:78267306-78267328 CGCTGAGCCCAGAGTGGAATGGG - Intergenic
1153860868 18:9204066-9204088 TACTGTCTCCAGAGTCGAGTTGG + Intronic
1154001698 18:10487307-10487329 CACTGAGCCCAGAATACAGCTGG - Intronic
1154382747 18:13867396-13867418 CACTGTGCCCAGCTTAAATTTGG - Intergenic
1156623752 18:38884064-38884086 CACTGTACCCTGAGCACAGTTGG + Intergenic
1160291629 18:77599880-77599902 CACTAGGCCCAGAATAGAGAGGG + Intergenic
1161767856 19:6216821-6216843 CTCTGTGCCCCGAGCAGAGGAGG - Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1162722549 19:12670896-12670918 CACTGTGCCCAGCTGAGAGTAGG - Exonic
1165222875 19:34331572-34331594 AACTTTGCCCAGAGTTGGGTGGG + Intronic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166351493 19:42200648-42200670 CACTGTGCCAAGAGGAGAGAAGG + Intronic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1168269932 19:55244310-55244332 CACAGGGCCTAGTGTAGAGTGGG - Intronic
1168335858 19:55597486-55597508 CCTTTTGCCCAGAGTACAGTGGG + Intronic
927702796 2:25278404-25278426 CCCTATGCTCAGAGTAGAGAGGG + Intronic
928009719 2:27595610-27595632 CACTGTGCCCGGTGGAGACTGGG + Intronic
928037609 2:27839809-27839831 GACTGATCCCAGAGCAGAGTGGG - Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
929124508 2:38511029-38511051 CACTGTCCCCAGAGCAGAGCAGG + Intergenic
929644096 2:43610098-43610120 CACAGTGCCCAGAACATAGTAGG - Intergenic
930238015 2:48906216-48906238 AACTGAGCCCAGAGCAGAGAAGG + Intergenic
930324300 2:49895527-49895549 CACTGTTCCCATAGTAGTTTAGG + Intergenic
931666191 2:64610948-64610970 CACTGTGCCCAGCCTATTGTTGG - Intergenic
933492749 2:83008570-83008592 CACTGTGCTCAGCCAAGAGTTGG + Intergenic
933639909 2:84747938-84747960 CTCTGAGCCAAGGGTAGAGTTGG + Intronic
933915373 2:86986601-86986623 CACTGGGCCCACATTAGAATGGG + Exonic
934007619 2:87783300-87783322 CACTGGGCCCACATTAGAATGGG - Exonic
934758083 2:96838666-96838688 CACTGCCCCAAGAGTTGAGTGGG + Exonic
935116103 2:100137816-100137838 ATCTATGCCCAGTGTAGAGTAGG + Intronic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
935771258 2:106424219-106424241 CACTGGGCCCACATTAGAATGGG - Exonic
935908819 2:107871730-107871752 CACTGGGCCCACATTAGAATGGG + Exonic
935995502 2:108767190-108767212 CACTGGGCCCACATTAGAATGGG + Exonic
936130603 2:109836844-109836866 CACTGGGCCCACATTAGAATGGG + Exonic
936214094 2:110534641-110534663 CACTGGGCCCACATTAGAATGGG - Exonic
936423230 2:112389200-112389222 CACTGGGCCCACATTAGAATGGG - Exonic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
939204988 2:139090154-139090176 CAGTGTGCCCAGAGTAGCCAAGG - Intergenic
939220083 2:139290712-139290734 CACTGTGCCTAGGGTAGAGGGGG - Intergenic
939415758 2:141894759-141894781 CACTGTGCCCAGCATAAATTAGG - Intronic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
940997372 2:160164401-160164423 CACTGTGCCCAGCCTAAAATGGG - Intronic
941981349 2:171460822-171460844 CACTGTGCCCAGCTGATAGTGGG + Intronic
943742401 2:191424332-191424354 CACAGTGCCTAGCATAGAGTAGG - Exonic
944315226 2:198277418-198277440 CCCTTTGCCAGGAGTAGAGTCGG + Intronic
945566500 2:211407037-211407059 CACTCAGGCCAGAGTACAGTGGG - Intronic
945799269 2:214405505-214405527 CACTGTGCCCAGCCTTGATTTGG - Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947628489 2:231636382-231636404 CACTGTGCCCAGCCTAGAAGGGG - Intergenic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
948483421 2:238264465-238264487 CCCTGGGCCAAGAGTAGAGGAGG + Intronic
948594881 2:239073518-239073540 CACTGTGCCAAGAGCACAGGCGG + Intronic
1169094791 20:2887768-2887790 CACTGTTACCAGAGCAGTGTGGG + Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172527101 20:35606468-35606490 CACTGTGCCCAGCCAAGAATGGG - Intergenic
1172941472 20:38657379-38657401 CACCGTGCCCAGCCCAGAGTGGG - Intergenic
1173456909 20:43210088-43210110 CACTGTGGCCAAAGTACAGCAGG + Intergenic
1173464536 20:43270576-43270598 CACTGTGCCCAGCTCATAGTAGG + Intergenic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174525848 20:51170567-51170589 CACTGGGCCCACACTTGAGTGGG - Intergenic
1175463080 20:59169475-59169497 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1175597057 20:60243687-60243709 CAATGAGGTCAGAGTAGAGTGGG - Intergenic
1177229346 21:18299553-18299575 CACTGCTGCCAGAGTAAAGTTGG + Intronic
1178363649 21:31970308-31970330 CACCGTGCCCAGAGAGGAGGTGG + Intronic
1179249239 21:39658951-39658973 CACTGTGCCCAGCCAAGAGCTGG - Intronic
1179408772 21:41146094-41146116 CACTGCGCACAGAGCTGAGTGGG - Intergenic
1180144681 21:45912650-45912672 CCCTGTGCCCAGAGAAGAAGTGG + Intronic
1180977400 22:19855779-19855801 CACGGTGCCTAGAGAAGAGGTGG + Intergenic
1181087000 22:20445071-20445093 CACTGTGCCCAGCTCAGAATGGG + Intronic
1181765007 22:25085170-25085192 CACAGTGCCCAGCACAGAGTAGG - Intronic
1181929629 22:26390085-26390107 CTCTCTGCCCAGAGTAGAAGTGG - Intergenic
1181930655 22:26398727-26398749 CACAGTGCCCAGCACAGAGTAGG + Intergenic
1182295992 22:29311495-29311517 CACTGTCCCCGGAGTAGCGGCGG - Intronic
1182339261 22:29606240-29606262 CACTGTGCCCTGCGAAAAGTTGG + Intronic
1182866260 22:33607039-33607061 CACAGTGCCTAGAAGAGAGTAGG + Intronic
1183078192 22:35439869-35439891 CATGGTGCCCAAAGCAGAGTGGG + Intergenic
1183432073 22:37771995-37772017 CACAGTGCCCAGGATATAGTAGG - Intronic
1184238813 22:43200825-43200847 CAGTGTGCCCAGGGCAAAGTTGG - Exonic
1184994796 22:48197552-48197574 GACTGTGCCCAGGGTAGATGTGG - Intergenic
1185268650 22:49918418-49918440 CTCTGTGCCCTGAGTAAAGATGG + Exonic
949113397 3:290631-290653 CCCTGTTCCTAGAGTACAGTAGG + Intronic
949366058 3:3281927-3281949 CACTGGGGCCAGAGCATAGTAGG + Intergenic
950004072 3:9680137-9680159 CAAGCTGTCCAGAGTAGAGTTGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
952286220 3:31972098-31972120 CACTGTGCCCGGCCCAGAGTTGG - Intronic
952726814 3:36595210-36595232 CTCTGTGGGCAGAGTAGAGTGGG - Intergenic
952739065 3:36717915-36717937 CACTGTGCCTGGTGCAGAGTTGG - Intronic
954307257 3:49735064-49735086 CACTGCGCCCAGTCTAGAGTGGG - Intronic
954455704 3:50598685-50598707 CATTGTCCCCAAAGTAGAGGTGG + Intergenic
954636651 3:52074505-52074527 CACTGTGCTCAGTGCAGAGCAGG - Intergenic
955372051 3:58360545-58360567 CACTGTGCCCAGCCTGGAGCTGG - Intronic
956168096 3:66411585-66411607 CACTGTTCACAGAGTAGGGAGGG + Intronic
956685504 3:71823971-71823993 CACCGTGCCCAGCCTAGAATAGG - Intergenic
957880282 3:86203307-86203329 CAATGTGCCCATAGTGGAGGGGG + Intergenic
958728041 3:97930189-97930211 CACTCTCCCCAGAGAAGAGCTGG - Intronic
960577226 3:119241108-119241130 CCCTGTGCCAATAGTAGACTGGG + Intergenic
961059032 3:123812888-123812910 CCCTGTGCCCACAGGAGAATTGG - Intronic
962734158 3:138309394-138309416 CACTGTGCCCAGCCAACAGTGGG - Intronic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
963205803 3:142632885-142632907 CACCGTGCCCAGCCTAGAGCAGG + Intronic
963948876 3:151176953-151176975 CACGGTGCCTGGTGTAGAGTAGG - Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
966398862 3:179527339-179527361 CGTTGTGCCCAGAATACAGTTGG + Intergenic
966974223 3:185070732-185070754 GAGTCTGCCCAGAGTAGAGATGG + Intergenic
968813248 4:2809361-2809383 CACTGAGCCCAGAGGAGGGAGGG - Intronic
970287909 4:14538937-14538959 CACAGTGGCCAGAATAGAATAGG + Intergenic
971272281 4:25161105-25161127 AACAGTGCCCAGAATAAAGTAGG + Intronic
974831411 4:67193856-67193878 CACTGTGCTCAGCATATAGTAGG + Intergenic
978857363 4:113408432-113408454 CTATGGGCCCAGAGCAGAGTGGG - Intergenic
980141283 4:128920570-128920592 CACTGTGCCCAGCCTAGAAAAGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981999420 4:151008684-151008706 CACTGCGCCCAGCCTAGAGGTGG - Intronic
982183515 4:152773006-152773028 CACTGTGCCCGGCCTAAAGTAGG + Intronic
982356278 4:154473236-154473258 CACTGAGCCCAGAGTTGTGGTGG - Intronic
982745923 4:159103798-159103820 CACTGTCCCCCGAGTGGAGCCGG + Intergenic
983952139 4:173654688-173654710 CACTGTCCACAAAGGAGAGTCGG - Intergenic
985004020 4:185514672-185514694 CACTGTGGCCAGAACAGAGCCGG + Intronic
986567670 5:9131318-9131340 CACTGCGCCCAGCTGAGAGTTGG - Intronic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987446376 5:18024563-18024585 CACAGTGCCCAGAATACAGCAGG + Intergenic
990298925 5:54431409-54431431 CACTGTGCCCAGCCTGGACTGGG - Intergenic
991091787 5:62700648-62700670 CACAGTGTCCAGCGTGGAGTAGG + Intergenic
991982017 5:72242137-72242159 CTCTGTCCCCAGTGTTGAGTAGG + Intronic
993118926 5:83751367-83751389 CACTGTGCCCGGACTATAGTAGG + Intergenic
993852273 5:93025029-93025051 AACTGTGCCCAGAGAACAGCAGG - Intergenic
995454634 5:112338363-112338385 GACAGTGCCGAGAGAAGAGTTGG - Intronic
997930636 5:138069889-138069911 CACTGTGCCCAGCCGAGAGATGG - Intergenic
998091549 5:139373813-139373835 CACAGTGGGCACAGTAGAGTGGG + Intronic
998167821 5:139854554-139854576 CAGTGAGCCCAGAGGAGACTGGG - Intronic
998254380 5:140573590-140573612 CACTGGGCCCAGCATACAGTGGG + Intronic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1000370543 5:160531765-160531787 CACTGTGCCCAAAGTATTGATGG + Intergenic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1001590942 5:172864766-172864788 CACTGTGCCCAGCATATAATAGG - Intronic
1001601057 5:172928650-172928672 CCCTGTACCCAGGGTATAGTAGG + Intronic
1001779949 5:174359634-174359656 CCAGGTGCCCAGAGCAGAGTAGG - Intergenic
1002095112 5:176826042-176826064 CCCTGTGACCAGACCAGAGTAGG - Intronic
1003415518 6:5904462-5904484 AACTGTGTCCAGGGTAGATTTGG + Intergenic
1005934511 6:30509971-30509993 CACTGTGCCCAGCGTAAACGTGG + Intergenic
1006308776 6:33242391-33242413 CACTGTGCCCAGTGTAATGCAGG - Intergenic
1007177748 6:39908342-39908364 CACGGTGCCCAGATTATAGCAGG - Intronic
1009311518 6:62159336-62159358 CTCTCTGCCAAGATTAGAGTAGG + Intronic
1011135673 6:84097299-84097321 CACAGTGCCCTGAAAAGAGTGGG - Intergenic
1013225999 6:108119669-108119691 CACCGTGCCCGGGGTAGAGGTGG - Intronic
1013597021 6:111669543-111669565 CACTCTGCCTAGAATAGTGTTGG + Intronic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014900567 6:126959190-126959212 CACTGTATTCAGAGTGGAGTAGG - Intergenic
1015251226 6:131130261-131130283 CACTCTGCTAAGAGTAGAGCAGG - Intergenic
1015289359 6:131520596-131520618 TCCTGTGACCAGATTAGAGTGGG - Intergenic
1016378907 6:143452907-143452929 CACAATGCCCAGCGTAAAGTGGG - Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018271787 6:162087490-162087512 CACAGTGCCTAGCGTAAAGTAGG - Intronic
1018703267 6:166444781-166444803 CACAGTGCCCAGCTTAGAGCAGG - Intronic
1019942824 7:4304725-4304747 CTCTGAGCCCAGCGTAGTGTTGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022465900 7:30653145-30653167 TACTGGGCCCAGAGCAGAGAAGG - Intronic
1022494279 7:30843553-30843575 CCTTGTGCCCTGAGCAGAGTCGG - Intronic
1022930413 7:35106632-35106654 CACAGTGCCTAGAATACAGTAGG - Intergenic
1024045249 7:45581249-45581271 CACTGAGCCCAGAACAGTGTGGG - Intronic
1025722576 7:64029803-64029825 GCCTGTGCCCTGAGTACAGTGGG - Intergenic
1027178136 7:75917873-75917895 CACTGTTCCCAGCCTAGAATTGG - Intronic
1027183417 7:75955128-75955150 CACTGTACCCAGCCTAGAATTGG + Intronic
1028228137 7:88273784-88273806 CCTTGTGGCCAGACTAGAGTGGG + Intergenic
1029009531 7:97243922-97243944 CACTGTGCCCAGCCAAGAGTTGG + Intergenic
1029826305 7:103199149-103199171 CACAGTGCCTAGAATACAGTAGG - Intergenic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1031459194 7:122025090-122025112 TACTGTGCCAGGAGTAGAATAGG - Intronic
1032796931 7:135285235-135285257 AACTGGGCCCAGAGTACACTTGG + Intergenic
1033719042 7:144037439-144037461 CACTGTGCCTAGAATATTGTAGG + Intergenic
1035862391 8:3043539-3043561 CATGGTGCCCAGCATAGAGTAGG + Intronic
1038214007 8:25545183-25545205 CACTGTGCCCAGCTGAGACTGGG + Intergenic
1038394241 8:27235367-27235389 CACAGTGTGCAGAGCAGAGTGGG + Exonic
1041332154 8:56738553-56738575 CACAGGGCCCAGAGAAGACTAGG - Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042351453 8:67781516-67781538 CACTGTGCCTAGCCTAGAGATGG + Intergenic
1042519961 8:69701042-69701064 CATTGTGTCCAGATGAGAGTAGG + Intronic
1042565333 8:70104863-70104885 CACTATGCCCTGCGTAGAGACGG + Intergenic
1043933687 8:86119115-86119137 CAATGTGCCCAGAATACACTGGG + Intronic
1047243697 8:123119012-123119034 CACTGTGCCCAGCCTAGAAATGG + Intronic
1047615751 8:126561269-126561291 CACAGTGCCCATTGTAGAATTGG - Intergenic
1047868214 8:129052946-129052968 CACAGTGCCTAGATTACAGTAGG + Intergenic
1048240924 8:132741074-132741096 CACTGTGCCCAGCCCTGAGTGGG - Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1048425367 8:134318642-134318664 CACAGTGCCAAGAATACAGTTGG - Intergenic
1048559289 8:135515501-135515523 CTCTGGGCACAGAGCAGAGTAGG - Intronic
1049488293 8:142877653-142877675 CACTGTGCCCAGGGCAGGGAAGG - Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051288019 9:15515668-15515690 CACTGTGCCCAACGTCCAGTGGG + Intergenic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1054941646 9:70749171-70749193 CACTGTGTCCAGACAAAAGTTGG + Intronic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1056105294 9:83341266-83341288 CACTGTGGAGAAAGTAGAGTGGG - Intronic
1057074019 9:92125533-92125555 CACTGTGCCCAGCCTACAATAGG - Intergenic
1057085370 9:92205023-92205045 CACTGTGCCCAGCCTACAATAGG + Intergenic
1057517214 9:95731952-95731974 CAATGTGCCCAGATAAAAGTTGG + Intergenic
1057722715 9:97545855-97545877 CTCTGTGCTCAGACTGGAGTCGG + Intronic
1057747182 9:97761710-97761732 AACAGTGCCCAGAGCATAGTAGG - Intergenic
1058090056 9:100795657-100795679 CACTGTGCCTAGCCTATAGTTGG + Intergenic
1059226533 9:112678090-112678112 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1059466480 9:114471869-114471891 AACCGTGCCCAAAGCAGAGTGGG - Intronic
1060823308 9:126673628-126673650 CTCTCTGCCCAGAGTGGAGGTGG - Intronic
1060894002 9:127205966-127205988 GACATTGCCCAGAGAAGAGTGGG + Intronic
1185434249 X:29404-29426 CACTGTGCCAACTTTAGAGTCGG + Intergenic
1186284704 X:8031106-8031128 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186284707 X:8031140-8031162 CACTGTGCACAGACTAAAGTGGG + Intergenic
1186752036 X:12631268-12631290 CACTGTACTCAGAATAGAATTGG + Intronic
1187555959 X:20351345-20351367 CACTCTTCCCAGACTAAAGTTGG - Intergenic
1189064913 X:37797094-37797116 CACTCTGCCCAGAGCCCAGTTGG + Intronic
1190212565 X:48459875-48459897 ATCTGTGGCCAGAGTAGGGTGGG + Exonic
1190337916 X:49273945-49273967 CACTGTGCCCAGCACACAGTAGG - Intronic
1190763381 X:53455134-53455156 CAGTGTGCCCAGAGTAGCCTGGG - Intergenic
1190841669 X:54151001-54151023 CACCGTGCCCGGACTAGAATGGG + Intronic
1190990839 X:55548761-55548783 CACTGTCCACATACTAGAGTAGG - Intergenic
1192218100 X:69177872-69177894 GACAGTGCTGAGAGTAGAGTAGG + Intergenic
1192246179 X:69373526-69373548 CATTGTAGCCAGAGTGGAGTGGG - Intergenic
1194413979 X:93588027-93588049 CTCTGTTCTCAGAGTAGGGTGGG + Intergenic
1196408222 X:115388290-115388312 TAGTGAGCCCAGAGTAGAATAGG + Intergenic
1196906801 X:120444885-120444907 CAATGTCCCCAGAGTTCAGTGGG - Intronic
1197193511 X:123675350-123675372 CACTGTGCCCAGCCTAGATAAGG - Intronic
1198311521 X:135429061-135429083 CACTGTGCTCAGTGCAGGGTCGG + Intergenic
1198637911 X:138720094-138720116 AATAGTGCCCGGAGTAGAGTTGG - Intronic
1199608649 X:149595617-149595639 CTCTGTGCCCAGAATCGAGTCGG - Intergenic
1199630473 X:149773743-149773765 CTCTGTGCCCAGAATCGAGTCGG + Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic