ID: 1048294501

View in Genome Browser
Species Human (GRCh38)
Location 8:133204548-133204570
Sequence GAATATTCAAAGAGGGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048294498_1048294501 -5 Left 1048294498 8:133204530-133204552 CCTAGAGAAACTTAAGGCGAATA 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG No data
1048294496_1048294501 6 Left 1048294496 8:133204519-133204541 CCAGGCTTCAGCCTAGAGAAACT 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1048294501 8:133204548-133204570 GAATATTCAAAGAGGGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048294501 Original CRISPR GAATATTCAAAGAGGGATCT AGG Intronic
No off target data available for this crispr