ID: 1048295855

View in Genome Browser
Species Human (GRCh38)
Location 8:133212854-133212876
Sequence CTGGAGAGAGGGCCTGCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 468}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048295855_1048295868 13 Left 1048295855 8:133212854-133212876 CCCCCCGCAGGCCCTCTCTCCAG 0: 1
1: 1
2: 4
3: 41
4: 468
Right 1048295868 8:133212890-133212912 GGACTTTACCCCAGCTCCACTGG 0: 1
1: 0
2: 1
3: 14
4: 117
1048295855_1048295862 -8 Left 1048295855 8:133212854-133212876 CCCCCCGCAGGCCCTCTCTCCAG 0: 1
1: 1
2: 4
3: 41
4: 468
Right 1048295862 8:133212869-133212891 CTCTCCAGCCCCTACGACCATGG 0: 1
1: 0
2: 0
3: 10
4: 142
1048295855_1048295869 16 Left 1048295855 8:133212854-133212876 CCCCCCGCAGGCCCTCTCTCCAG 0: 1
1: 1
2: 4
3: 41
4: 468
Right 1048295869 8:133212893-133212915 CTTTACCCCAGCTCCACTGGAGG 0: 1
1: 1
2: 0
3: 17
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048295855 Original CRISPR CTGGAGAGAGGGCCTGCGGG GGG (reversed) Exonic
900368734 1:2322111-2322133 CTGGAGGGCGGCCCTGCTGGGGG + Intronic
900465734 1:2824681-2824703 CTGGAGGTGGGGCCGGCGGGAGG - Intergenic
900649494 1:3723955-3723977 CAGGAGAGGTGGCCTGCAGGAGG + Intronic
901078491 1:6570332-6570354 CTTGGCAGAGGGCCTGCAGGTGG + Intronic
901241195 1:7694685-7694707 CAGCAGAGAGGGCCGGAGGGAGG - Intronic
901685201 1:10939973-10939995 CAGGAGAGAGGGACTCAGGGAGG + Intergenic
901756876 1:11446823-11446845 CTGGAGAGAGGGGCGGGGTGAGG - Intergenic
901822703 1:11840369-11840391 CTGGTCAGAGGTCCTGGGGGTGG + Exonic
902250884 1:15153709-15153731 CGGGAGGGAGGGACCGCGGGAGG - Intronic
902730248 1:18364409-18364431 GTGGAGGGAGGGACTGCAGGGGG - Intronic
902816091 1:18917585-18917607 GTGGAGAGAGGGCCCCAGGGAGG + Intronic
903328726 1:22586145-22586167 CTGGAGACAGGGCCTGGGGGAGG + Intronic
903476041 1:23619721-23619743 CGGGAGAGAGGGCAGGGGGGAGG - Intronic
903671021 1:25035253-25035275 CTGGAGAGTGGGCCTCAGGATGG + Intergenic
904366165 1:30012142-30012164 ATGGAGAGGGTGCCTGGGGGCGG - Intergenic
904591419 1:31617632-31617654 GGGGAGGGAGGGCCGGCGGGAGG - Intergenic
905018416 1:34792892-34792914 CTGGAGAGAGGGCGGGGGCGGGG - Intronic
905241238 1:36582965-36582987 CTGGAGGATGGGCCTGGGGGAGG - Intergenic
905324160 1:37138646-37138668 CTGGAGAGAGGCCCAGCAGGAGG + Intergenic
905789159 1:40781300-40781322 GTGGAGACAGGGCCTGGGGGTGG + Intergenic
905858378 1:41330048-41330070 CTGGAGAAGGGGCCTGGGGCTGG - Intergenic
906083296 1:43108074-43108096 CTGGAGGAGGGGCCTGCTGGTGG - Intergenic
906650289 1:47508178-47508200 CCGGAGACAGGGCGGGCGGGTGG + Intergenic
906704858 1:47887568-47887590 CTGGGGTGGGGGCCGGCGGGGGG + Intronic
907023265 1:51089311-51089333 TTGGAGATGGGGCCTGTGGGAGG - Intergenic
907608840 1:55847326-55847348 CAGGAGAGATGGCCTCCAGGAGG + Intergenic
907797394 1:57731307-57731329 CAGGGGACAGGGCCTGGGGGTGG + Intronic
908563102 1:65326642-65326664 CTGGAGAGGGGGCTTCCAGGAGG - Intronic
908714253 1:67053620-67053642 CTGGCGAGCGGGCCTGTGGCAGG - Intronic
909183128 1:72450037-72450059 CTGGAGAGAGGGGTAGTGGGTGG - Intergenic
909533392 1:76706743-76706765 CTAAATAGAGGGCCTGAGGGTGG - Intergenic
910278972 1:85477364-85477386 CTGTAGAAAAGGCCTGAGGGCGG - Intronic
910845584 1:91601873-91601895 CTGGTGAGAGGCCCTGGGAGAGG - Intergenic
911162125 1:94691803-94691825 CAGGAGAGAGGGGATGTGGGGGG + Intergenic
912713524 1:111966160-111966182 CTGGAGAGAGGGTAAGCGTGTGG - Intronic
913209392 1:116570608-116570630 CTCGGGAGGGGGCCGGCGGGGGG + Intronic
913657526 1:120975459-120975481 CTGGGAAGAGGGCATGCTGGCGG - Intergenic
914522092 1:148426732-148426754 CTGGGAAGAGGGCATGCTGGTGG - Intergenic
914647506 1:149667194-149667216 CTGGGAAGAGGGCATGCTGGTGG - Intergenic
915275012 1:154782557-154782579 TTGGAGAAAGGGTCTGTGGGAGG - Intronic
915507032 1:156364343-156364365 CTGGAGATGGGGCCTTTGGGAGG - Intronic
915830863 1:159128631-159128653 CTGGAAAGAGGGGGTGTGGGAGG - Intronic
915894252 1:159799087-159799109 ATGGAGAGAGGGAATGAGGGTGG + Intergenic
915914203 1:159931422-159931444 CTGGAGAGAGGGCCAGGGGCTGG - Intronic
916833203 1:168514047-168514069 CTGATGAGAGGGACTGCAGGGGG + Intergenic
922213417 1:223502180-223502202 CAGGAGAGAGGAGCTGAGGGAGG + Intergenic
924567435 1:245210331-245210353 CTGCAGAGTGGGCCTGTGCGGGG - Intronic
924740016 1:246789607-246789629 CTGGAGAGGGCGGCTGCGGAGGG - Intergenic
1062782987 10:233356-233378 CTGGGGAGAGGGCGTGGGAGTGG - Intronic
1062790483 10:301211-301233 CAGGAGAGAGGGCCGTGGGGTGG + Intronic
1062919180 10:1266376-1266398 CTGGGGAGAATGCCTGAGGGTGG + Intronic
1062953715 10:1526195-1526217 TTGGAGAGATGGCCTGGGGCAGG + Intronic
1065242271 10:23718819-23718841 TTGGAGAGAGGGATTGAGGGAGG + Intronic
1065245043 10:23748162-23748184 TTGGAGAGAGGGAGTGAGGGAGG - Intronic
1067217775 10:44316798-44316820 CTGGTGGGAGGGGCTGAGGGTGG - Intergenic
1071526433 10:86362375-86362397 CTGGAGATAGAGACTGCTGGTGG + Intronic
1072637292 10:97186111-97186133 CGGGAGAGGGGGGCTGCGGCGGG - Intronic
1073117884 10:101102377-101102399 CAGGAGAAATGGCCTGCGGGAGG - Intronic
1073444299 10:103571521-103571543 CTGGAGCGGGGCCCTGCGGCTGG + Exonic
1073650651 10:105354591-105354613 ATGGAGAGAGGGACTCCTGGTGG + Intergenic
1073938849 10:108670038-108670060 CTGGAGATAGGGCCTTTAGGGGG + Intergenic
1074112747 10:110434008-110434030 CTGCAGGGAGGCTCTGCGGGCGG - Intergenic
1074776517 10:116771549-116771571 CTAGACAGAGGGCCCCCGGGAGG + Intergenic
1075115050 10:119619180-119619202 GTGGGGAGAGGGTCTGCTGGAGG + Intergenic
1075343854 10:121668035-121668057 CAGCAGAGAGGTCCTGGGGGAGG - Intergenic
1076217955 10:128710990-128711012 CTCGAGGGAGGGCTTGCAGGAGG + Intergenic
1076564177 10:131386863-131386885 GTGGAGAGAGGGGCAGAGGGAGG + Intergenic
1076714177 10:132354867-132354889 CTGGAGAGCTGGCCTTCCGGGGG + Intronic
1077146507 11:1048911-1048933 GTGGCGATAGGGACTGCGGGTGG - Intergenic
1077235017 11:1477494-1477516 CTGGAGATGGGGCCTTTGGGAGG + Intronic
1077340223 11:2023145-2023167 GGGTAGACAGGGCCTGCGGGAGG - Intergenic
1077356721 11:2122173-2122195 CTGGAGGGAGCGGCTGCAGGCGG + Intergenic
1077402292 11:2365169-2365191 CTGGAGGTGGGGCCTGCTGGAGG - Intergenic
1077453826 11:2666182-2666204 CTGGAGAGTGGGACTGAGGGCGG - Intronic
1077488687 11:2850667-2850689 CCGAAGAAAGGGGCTGCGGGAGG - Intergenic
1078164555 11:8871036-8871058 CTGCAGAGAGGGCGGGCGGCGGG + Intronic
1078441246 11:11370678-11370700 CTGGAGTGTGGGCCTGGGTGAGG - Intronic
1078594627 11:12675118-12675140 CGGGAGAGGGGGCGCGCGGGGGG - Intronic
1079159339 11:17977674-17977696 ATGGAGACAAGGCCTGTGGGAGG + Intronic
1079233956 11:18674202-18674224 TTGGAGATGGGGCCTACGGGAGG - Intergenic
1079452121 11:20606333-20606355 CTGGAGAAAGGTACTGTGGGAGG + Intronic
1080448836 11:32362177-32362199 CTGGTGGGAGGGGCTGGGGGTGG - Intergenic
1081528943 11:43944840-43944862 CTGGAGGGAGGGTCTGGGAGAGG - Intergenic
1081603988 11:44515389-44515411 CTGGACAGAGGGACAGCTGGAGG - Intergenic
1081793451 11:45804660-45804682 CTTGGGAGAGGGCCTGGGGGCGG + Exonic
1081915338 11:46726897-46726919 CTGCAGGCAGGGCCTGAGGGTGG - Intronic
1082807148 11:57458619-57458641 CTGGGGGGAGGGCCTGGAGGCGG - Intergenic
1083779785 11:64911855-64911877 CTGGGCAGAGAGCCGGCGGGAGG + Exonic
1083827928 11:65213675-65213697 CTAGAGAAAGGGCATGGGGGAGG + Intergenic
1083843391 11:65317018-65317040 CAGGAGAGAAGTCCTGGGGGGGG - Intronic
1083989994 11:66241012-66241034 CTGGAGAGAAGGCCTGAGCCCGG - Intronic
1084207692 11:67605465-67605487 CAAGAGAGGGGGCCTGCGGCTGG + Intronic
1084438344 11:69156981-69157003 CTGGAGGGAGGTGCTGCTGGGGG + Intergenic
1084606356 11:70174645-70174667 CTGGAAAGTGGGACTGAGGGAGG - Intronic
1084950547 11:72662913-72662935 CTGGAGGAAGGGCCTGGCGGTGG - Intronic
1085406701 11:76267414-76267436 CTGGAGAGGAGACCTGGGGGTGG - Intergenic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1089126779 11:116181769-116181791 CTCGTAAGAGGGCCTGCGGTGGG - Intergenic
1089294068 11:117457630-117457652 AGGGAGAGGGGGCCTGCTGGAGG + Intronic
1089577842 11:119459440-119459462 CTGGACAAAGGGAATGCGGGTGG + Intergenic
1089734591 11:120541021-120541043 CTGGAGAGAGAGGCTGGGGCAGG - Intronic
1089869142 11:121656889-121656911 CTCGCCAGAGGGCCTGCAGGAGG - Intergenic
1202823208 11_KI270721v1_random:78334-78356 GGGTAGACAGGGCCTGCGGGAGG - Intergenic
1091445529 12:542535-542557 CTGGACAGAAGCCCTGGGGGAGG + Intronic
1093703826 12:22253287-22253309 CTGGAGAGGGTGCCTGAAGGTGG + Intronic
1094183650 12:27617994-27618016 CAGGAGAGAGGGAATGAGGGAGG - Intronic
1094406205 12:30118951-30118973 CTGTAGGGCGGGCCTGCGGCTGG - Intergenic
1096865174 12:54558352-54558374 CTGGACAGAGGAGCTACGGGTGG - Intronic
1096885671 12:54716820-54716842 CTGGAGAGGGGGGCTGGCGGGGG - Intergenic
1096981180 12:55728884-55728906 CTGGAGGAAGGGACTGCGGGTGG + Intronic
1097191761 12:57222724-57222746 CTGGAGGGTGGGCCTGAGAGAGG - Intronic
1097196157 12:57243412-57243434 TTGAGGAGAGGGCCTGCGGAGGG - Intergenic
1098940034 12:76523539-76523561 GTGGAGATAGGGCCTTGGGGAGG + Intronic
1100391342 12:94148490-94148512 GTGGAGGGAGGGCGGGCGGGCGG + Intergenic
1100767571 12:97884694-97884716 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1100799230 12:98213742-98213764 CTGGAGAGAGTGGCTGCTGCAGG + Intergenic
1101749356 12:107570765-107570787 CTGGAGAGAGAGGCAGGGGGAGG - Intronic
1102227653 12:111240333-111240355 CTAGAGAGAGGGCTGGAGGGGGG - Intronic
1102571625 12:113830412-113830434 CTGGAGAGTGGGTCGGTGGGTGG + Intronic
1102781967 12:115573206-115573228 CGGGAGAGGGAGCCTGCGGGAGG - Intergenic
1103154121 12:118668720-118668742 ATGGAGTGGGGGCCTGGGGGAGG - Intergenic
1103847232 12:123909860-123909882 CTGGGGAGTGGGCATGGGGGTGG + Intronic
1104595050 12:130115256-130115278 CGGCAGAGGGGGCTTGCGGGAGG - Intergenic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105825289 13:24116795-24116817 TTGGAGAAAGGGCCTTTGGGAGG + Intronic
1106181306 13:27371900-27371922 CTGGAGTGAGGGCTGGAGGGCGG + Intergenic
1106232136 13:27828642-27828664 ATGGGGAGAGGGGCTGCAGGAGG + Intergenic
1109252000 13:60031334-60031356 CTGGAGGTGGGGCCTGGGGGAGG - Intronic
1113487456 13:110664742-110664764 CTGAAGGCAGGGCCTGTGGGAGG + Intronic
1113499940 13:110765293-110765315 TTGGAGGCAGGGCCTGTGGGAGG + Intergenic
1113593330 13:111515413-111515435 CTGGTGTGAGGGTCTGAGGGTGG + Intergenic
1113593339 13:111515442-111515464 CTGGTGTGAGGGTCTGAGGGTGG + Intergenic
1113593348 13:111515471-111515493 CTGGTGTGAGGGTCTGAGGGTGG + Intergenic
1113593357 13:111515500-111515522 CTGGTGAGAGGGTCTGAGGGTGG + Intergenic
1113656735 13:112072528-112072550 ACGGAGCGAGGGCCGGCGGGGGG + Intergenic
1113790058 13:113023469-113023491 CTGGAGACAGTGGCTGTGGGGGG + Intronic
1113792598 13:113037070-113037092 GTGCAGAGAGGGGCTGGGGGAGG + Intronic
1113942464 13:114025428-114025450 CTGCAGAGAGGGCATGAGGCAGG - Intronic
1113942482 13:114025492-114025514 CTGCAGAGAGGGCGTGAGGCAGG - Intronic
1114269974 14:21094554-21094576 CTGGAGTGAGGGACGGGGGGCGG + Intronic
1118009168 14:61592063-61592085 CTGGAGGGAGGGGCTGGGGCAGG - Intronic
1118220850 14:63853384-63853406 TTGGAGCGAGCGCCAGCGGGTGG + Intronic
1119724145 14:76911881-76911903 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1119753433 14:77097757-77097779 TGGGAGAGCGGGCGTGCGGGCGG - Intergenic
1120666616 14:87314090-87314112 CTGGAGAGAGGGAATCCAGGGGG - Intergenic
1120718696 14:87867690-87867712 TTAGAGAGAGGGCCTAAGGGGGG - Intronic
1121208746 14:92190674-92190696 CTGGTGAGAGGTCCTGGAGGAGG + Intergenic
1122028670 14:98896427-98896449 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1122349156 14:101077678-101077700 CTGGAGGGAGGGGCTACGGGGGG + Intergenic
1122594176 14:102877824-102877846 GTTGAGGGAGGGCCTGCGGAAGG - Intronic
1122905742 14:104800741-104800763 GCGGGGAGAGGGCCGGCGGGCGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123069671 14:105636324-105636346 CTGAAGAGAGGGGCAGAGGGAGG - Intergenic
1123094695 14:105761364-105761386 CTGAAGAGAGGGGCAGAGGGAGG - Intergenic
1124340118 15:28885343-28885365 CTGGAGTGAGGCCCTGGGGCTGG + Intronic
1124348391 15:28937520-28937542 CAGGAGAAAGGGCCTCCTGGTGG + Intronic
1124719344 15:32098188-32098210 CTGCACAGAGGACCTGGGGGAGG - Intronic
1124983558 15:34584353-34584375 CTGGAGTGAGGCCCTGGGGCTGG - Intronic
1126325576 15:47473361-47473383 CTTGAGAGAGGGTCTGTGGCTGG + Intronic
1128053790 15:64684939-64684961 CTGGGGACAGGGCCTGGGAGGGG - Exonic
1128496378 15:68200825-68200847 ATGAAGCGAGGGCCTGGGGGTGG - Intronic
1128943934 15:71809064-71809086 CTGGCAAGTGGGCCTGGGGGTGG + Intronic
1129372295 15:75105198-75105220 CTGGAGAGTGGTACTGCGTGTGG - Intronic
1129552549 15:76468791-76468813 CTGGAGACGGGGCCTGTGGGAGG + Intronic
1129683381 15:77671073-77671095 CTGGGGAGGGGCCCTGCGGGAGG - Intronic
1129903194 15:79167434-79167456 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1130968804 15:88717006-88717028 TGGGAGAGAGTGCCTGCCGGCGG - Intergenic
1132534554 16:471602-471624 CTGGCGACAGGCCCTGGGGGAGG - Intronic
1132677807 16:1127836-1127858 CTGGAGGGAGGGGCTTCTGGAGG - Intergenic
1132936452 16:2483702-2483724 CTGGAGAGAGAGGAGGCGGGTGG + Intronic
1135684057 16:24483622-24483644 GTGGAGAAAGGGCCTTTGGGAGG - Intergenic
1136174072 16:28505661-28505683 CTGGAAAGAGGGGCAGCGGATGG + Intronic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136363937 16:29799870-29799892 GTGGAGAGAGGGATTGGGGGTGG - Intronic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136496969 16:30650839-30650861 CTGGAGAGAGGGCGGGAGTGGGG + Intronic
1137027454 16:35492273-35492295 CCTGAGAGAGGGACTGCGGCCGG - Intergenic
1138591036 16:58000096-58000118 CTGCAGGCAGGGCCGGCGGGAGG - Intronic
1139209004 16:65057859-65057881 CTGGGGAGTGGGCCTCCTGGTGG - Intronic
1139289368 16:65843690-65843712 CTGGAAAGGGGGTCAGCGGGGGG - Intergenic
1139590185 16:67929004-67929026 CTGGAAGGAGCCCCTGCGGGAGG + Exonic
1140588658 16:76324876-76324898 TTGGAGAGGGGGCCTTTGGGAGG - Intronic
1141153667 16:81582174-81582196 TTGGAGAAGGGGCCTGTGGGAGG - Intronic
1141195988 16:81861738-81861760 GTGGAGAGAGGCACTGAGGGTGG - Intronic
1141604283 16:85144153-85144175 CTGGGCAGAGGCCCTGCAGGAGG + Intergenic
1141908199 16:87041422-87041444 CTGGAAGCAGGGCATGCGGGAGG - Intergenic
1142136852 16:88455518-88455540 CTGGCAAGAGGGCGGGCGGGCGG - Intronic
1142377304 16:89712510-89712532 GTAGAGAGAGGGTCTGGGGGGGG + Exonic
1142621118 17:1166275-1166297 CTGGAGAGAAGCCCTGCATGGGG - Intronic
1142631946 17:1230829-1230851 CTGGAGAGGGGGCCTGGAGACGG + Intergenic
1142681939 17:1555111-1555133 CTGGGGAGAGGGCCTGGTGGAGG + Intronic
1143832232 17:9661767-9661789 CTGGAGTGAGGGGCAGCAGGGGG - Intronic
1144033443 17:11342358-11342380 CAGGAGAGAGGGCGTGTTGGAGG + Intronic
1146009184 17:29180217-29180239 CGGGAGGGAGGGCGGGCGGGCGG - Intronic
1146717869 17:35101327-35101349 CTCGAGACAGGGACAGCGGGAGG - Exonic
1146896674 17:36546017-36546039 CTGGAGAGAGGGAGTGCGTACGG - Intronic
1147210540 17:38870368-38870390 ATGGAGGGAGGGCGAGCGGGCGG + Intronic
1148644781 17:49213470-49213492 GGGGAGAGAGGGGCTGCAGGTGG - Intronic
1148697719 17:49571046-49571068 CTGGACAGGGGGCCTGCAAGGGG - Intergenic
1150008934 17:61487270-61487292 GGGGAGAGAGGGCTTGCCGGGGG - Intergenic
1151016182 17:70555853-70555875 CTGGAGAGAGGGAATGAGGGAGG + Intergenic
1151175602 17:72285378-72285400 CTGCAGAGAGGGCCTGGGAGCGG + Intergenic
1151882970 17:76905911-76905933 CTGGAGACAGGGTCTGCTGCCGG + Intronic
1151979154 17:77498706-77498728 GTGGTGGGAGGGCCTGGGGGGGG - Exonic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152308532 17:79535386-79535408 CTGGAGAGAGGCCTTGCTGGTGG - Intergenic
1152438096 17:80288374-80288396 CGGGAGAGATGGCCTGGGAGTGG + Intronic
1152570397 17:81119064-81119086 CCGGTGAGAGGGCCTGCCGCAGG + Intronic
1152571834 17:81124406-81124428 CTGGGGAGAGGGTCTGGGTGGGG - Intronic
1152617965 17:81346375-81346397 CTGGCGGGAGGGGCTGCGGGCGG + Intergenic
1152626896 17:81391934-81391956 CTGGGGAGAGGGCCAGCGAGGGG - Intergenic
1152930554 17:83107538-83107560 CTGGAGAGAGGGCCCTCATGGGG + Intergenic
1153323672 18:3796953-3796975 CTGGAGATGGGGCCTTTGGGAGG + Intronic
1154502682 18:15004503-15004525 CTGGGGACAGGGCCCGCGGGCGG + Intergenic
1155071961 18:22324808-22324830 GTGGACAGAGGGCCCCCGGGAGG + Intergenic
1155380045 18:25210764-25210786 CTGGAGAGAGGGGCAGAGGCTGG - Intronic
1155668036 18:28335344-28335366 GTGGAGATGGGGCCTTCGGGGGG + Intergenic
1156171858 18:34494444-34494466 CTGGACAGAGGGCAGGCGGGAGG + Intronic
1157530112 18:48413288-48413310 CTGAAGAGAGGGCCCAAGGGTGG - Intergenic
1159497731 18:69227577-69227599 CTGGAGACGGGGCCTGGTGGGGG + Intergenic
1160146833 18:76372046-76372068 CAGGAGAGAGGGCCAGAGGTGGG - Intronic
1160497515 18:79383958-79383980 CTGGAGAGTGGGCCTGCCAGGGG - Intergenic
1161320535 19:3638739-3638761 CTGGTGAGAGAGCATGTGGGTGG + Intronic
1161398775 19:4058627-4058649 CTGGGGAGAGGGCCTGAGCTGGG + Intronic
1161564156 19:4990425-4990447 CTGGAATGAGGGCCTGGGGCAGG + Intronic
1161589522 19:5123011-5123033 CTGGAGAGACCCCCTGCTGGTGG + Intronic
1161667488 19:5586049-5586071 TTGGAGGAGGGGCCTGCGGGTGG + Intergenic
1161804431 19:6434287-6434309 TTGGAGACAGGGCCTTTGGGAGG + Intergenic
1161943243 19:7418979-7419001 CTGGGGTGAGGGGCTGCTGGGGG - Intronic
1163093340 19:15036451-15036473 GTGGAGAAAGGGCCTGGGGCAGG + Intergenic
1163331030 19:16637900-16637922 TTGGAGACAGGGCCTTTGGGAGG + Intronic
1164501376 19:28823178-28823200 GTGGAGAGGGGGCATGGGGGTGG + Intergenic
1164611349 19:29634580-29634602 CTGGGGAGAGTGCCTGAGGGAGG + Intergenic
1164706053 19:30321057-30321079 CTGGAGCCAGAGCCTGCGAGGGG - Intronic
1164961543 19:32435262-32435284 TTGGAGACAGGGCCTACAGGAGG - Intronic
1165334869 19:35162652-35162674 TTGGAGCGAGGGCCTTTGGGAGG - Intronic
1165422121 19:35727520-35727542 CTGGCGAGAGGCCCTGAGCGGGG + Exonic
1165871423 19:38975823-38975845 CGGGAGCGAGGGCGGGCGGGCGG + Exonic
1165896559 19:39145174-39145196 CTGGGCAGCGGGCCTGAGGGTGG - Intronic
1166276150 19:41755645-41755667 CTGCAGGGAGGGGCTGAGGGGGG - Exonic
1167660141 19:50791623-50791645 GTGGAGAGAGGGCACGCGGGGGG - Intronic
1168016936 19:53581483-53581505 CTGGAGAGAGGCCTTGGGGCTGG + Intergenic
925202698 2:1981740-1981762 CTTGAGAGAGGGCATGGAGGGGG + Intronic
925306029 2:2848884-2848906 CTGTTGAGAGGGCCTGGGTGGGG + Intergenic
925657892 2:6168940-6168962 CTGGAGAGAGGGAAGGAGGGAGG - Intergenic
925865475 2:8222749-8222771 TTGGAGATAGGGCCTGTAGGAGG - Intergenic
926893305 2:17657690-17657712 CTGGAGAGATGGCCAGCAGCGGG + Intergenic
927596651 2:24403208-24403230 CTGGGGGGAGGGCGGGCGGGGGG - Intergenic
929608644 2:43253247-43253269 CTGGATAGAGGTCATGGGGGAGG + Intronic
931673230 2:64668405-64668427 CTGCAGAGAGGGCCAGAGAGGGG + Intronic
931676610 2:64702662-64702684 CTGGGTGGAGGGCTTGCGGGAGG + Intronic
931695128 2:64865460-64865482 CTGTGGAGGGGGCCTGCTGGCGG + Intergenic
933711326 2:85328006-85328028 CTGGAGAGGGGCCCCGCGCGCGG - Exonic
934106363 2:88698664-88698686 CTGGAGAGAGGGACTACCTGAGG + Intronic
934712738 2:96526589-96526611 CTGGACACAGGGGTTGCGGGGGG + Intergenic
936076308 2:109403905-109403927 GTGGAGTGAGGGCGTGCGTGCGG + Intronic
938068238 2:128293172-128293194 CAGGAGACAGGGTGTGCGGGTGG - Intronic
938501851 2:131834673-131834695 CTGGGGACGGGGCCCGCGGGCGG + Intergenic
938823716 2:134983615-134983637 GTGGAGGGAGGGACTGTGGGGGG + Intronic
939956809 2:148534212-148534234 CTGCAGAGAAGGCCTTCGAGAGG - Intergenic
942968751 2:181930922-181930944 CTGGAGAGAGGGCATGATTGAGG + Intergenic
943480221 2:188408059-188408081 CTGGAGGTAGGGCCTTTGGGAGG + Intronic
944539775 2:200744028-200744050 CTTGAGAGTGGGCCTTGGGGAGG + Intergenic
946408473 2:219505106-219505128 CTGGAGAGAGGGGCTTAGAGAGG + Intronic
946668485 2:222076463-222076485 CCGGCAAGAGGGCCTGAGGGAGG - Intergenic
947951409 2:234150733-234150755 AGGGAGAGAGGGCATGCTGGAGG + Intergenic
948692456 2:239715287-239715309 AGGGAGAGAGGGGCTGCTGGTGG - Intergenic
948777936 2:240299502-240299524 CTGGAGAGAGGGTCATGGGGAGG - Intergenic
948890407 2:240904647-240904669 CTGGTGAGAGTTCCTGCTGGGGG - Intergenic
948919001 2:241052674-241052696 CAGGTGAGAGGGTCGGCGGGGGG + Intronic
1168957650 20:1845856-1845878 CTGGAGGAAGGGCCAGCAGGAGG + Intergenic
1169390446 20:5186326-5186348 CTGGAGAGAGGCCATGGGGAAGG - Intronic
1169406010 20:5321887-5321909 CTGGAGAGAGGGGCTTCAGCTGG - Intergenic
1170343718 20:15358883-15358905 CTGGAGGTGGGGCCTTCGGGAGG - Intronic
1170393025 20:15895625-15895647 CAGGAGAGAGGGCCTGGTGGCGG + Intronic
1170432941 20:16293907-16293929 ATGAGGAGAGGGGCTGCGGGGGG + Intronic
1170557692 20:17528647-17528669 CCTGGGAGAGGGCCTGTGGGTGG - Intronic
1170921547 20:20684202-20684224 CAAGAGAGAGGGCCGGGGGGAGG - Intronic
1170999299 20:21396924-21396946 CAGGAGCGCGGGGCTGCGGGCGG - Intronic
1171484462 20:25477125-25477147 CCCGAGAGAGGGGCTGGGGGCGG - Intronic
1172121351 20:32600795-32600817 CTGGAGAGAGGTCCTGGGCTGGG + Intronic
1172908366 20:38386795-38386817 CTGGAGGTAGGGCCTCTGGGAGG - Intergenic
1173188891 20:40861517-40861539 CTAGAGAGAGGGGCAGTGGGTGG - Intergenic
1173803824 20:45911451-45911473 ATGGCGAGCGGGCCTGGGGGTGG + Exonic
1174130980 20:48343159-48343181 CTGGAGTGAGGGCCTGTCAGGGG + Intergenic
1174450008 20:50613961-50613983 CAGCAGAGAGGGCCTCGGGGTGG - Intronic
1174736719 20:52972218-52972240 CAGGGGAGAGGGGCTGGGGGCGG - Intergenic
1174765240 20:53247420-53247442 CTGGAGTGAGGGCCTCTTGGAGG - Intronic
1174783625 20:53412732-53412754 CAGGGGAGAGAGCCTGTGGGTGG - Intronic
1175086161 20:56460945-56460967 CTGGACAGAGGCCCTCCAGGGGG + Intergenic
1175596633 20:60239766-60239788 CTGGAGGGAAAGCCTGAGGGTGG + Intergenic
1175760059 20:61556348-61556370 ATGGAGAGAGAGGCTCCGGGGGG + Intronic
1175825495 20:61934401-61934423 TTGGAAAGAGGGCCTGCTGAGGG - Intronic
1175894676 20:62330826-62330848 CTGGAGTGAGATCCTGCGCGTGG + Exonic
1176066994 20:63203063-63203085 GTGGAGAGGGTGCCTGCTGGGGG + Exonic
1178299190 21:31437593-31437615 TTGGAGAAAGGGCCTGTGGGAGG + Intronic
1178870488 21:36370298-36370320 CTGAGGAGAGGGCCTCCTGGAGG + Intronic
1179108125 21:38421783-38421805 CTGGAGATAGGGCCTTTGTGGGG + Intronic
1179128270 21:38611573-38611595 CTGGAGTGAGGGCCTGTGGGAGG - Intronic
1179305733 21:40152558-40152580 CTGGAGAAAGGGCATCTGGGAGG - Intronic
1179429891 21:41314069-41314091 TTGGAGATAGGGCCTTTGGGAGG + Intronic
1179630452 21:42674638-42674660 CAGCAGAGAGGACCTGGGGGAGG - Intronic
1180231160 21:46427518-46427540 TTGGAGATGGGGCCTGCGGGAGG - Intronic
1180235919 21:46459272-46459294 CCGGAGTGAGGGGCTGCGCGGGG - Intronic
1180235930 21:46459298-46459320 CTGGAGTGAGGGGCCGCGCGGGG - Intronic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1182516091 22:30859928-30859950 CTGCAGAGAGGGGCCGGGGGCGG - Intronic
1182963304 22:34497138-34497160 TTGGAGATAGGGCCTTTGGGAGG + Intergenic
1183346589 22:37311589-37311611 GTGGGGAGAGGGCCTGAGGCTGG + Intronic
1183403850 22:37620297-37620319 CTGGACAGTGGGCCTGCCCGAGG + Exonic
1183704887 22:39470223-39470245 CTGGAGAGAGGGCTTGCGGGCGG + Intronic
1184509401 22:44924463-44924485 TTGGAGATGGGGCCTCCGGGAGG + Intronic
1185232187 22:49689682-49689704 CTGGAAGGAGGGGCTGGGGGAGG - Intergenic
950005327 3:9687705-9687727 CTGGAGAGCGGCCCTGCTGTGGG - Intronic
950032060 3:9859931-9859953 CAGCAGAGAGGGCCTGCGTGAGG + Intergenic
950571626 3:13803797-13803819 CTGGAGTGAGGTCCTGCTGGTGG + Intergenic
952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG + Intronic
955060431 3:55488136-55488158 CGGGAGAGCGGGCCGGCGGGAGG + Intronic
955579680 3:60405423-60405445 GTGGAGAGGGGTCATGCGGGTGG - Intronic
956192861 3:66623602-66623624 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
956470281 3:69559370-69559392 TTGGAGACAGGGCCTTTGGGAGG + Intergenic
960286947 3:115840343-115840365 CGGGAGAGGGGGGGTGCGGGGGG - Intronic
961433610 3:126901008-126901030 TTGGAGGTAGGGCCTGGGGGGGG - Intronic
961784812 3:129341368-129341390 CAGCAGAGAGGGCCTGCATGAGG + Intergenic
962318915 3:134375201-134375223 CTGGACAGAGCGCCTGGCGGCGG - Exonic
963069276 3:141289457-141289479 CTTCAGAGAGGGCTTGGGGGTGG - Intronic
963250411 3:143097399-143097421 TTGGAGATAGGGCCTCTGGGAGG + Intergenic
965609649 3:170530877-170530899 GAGGAGAGAGGCCCTGCGGCAGG + Intronic
966243024 3:177775505-177775527 CTGGAGAAAGGGTATGGGGGAGG + Intergenic
966411784 3:179652920-179652942 CTGGAGAGGGGCCCTGCGCGTGG - Exonic
966661237 3:182417361-182417383 CTGGAGAGTGGCCCTGAGGTAGG - Intergenic
968407598 4:354273-354295 CATGAGAGAGGGTCTGTGGGGGG - Intronic
968460045 4:720269-720291 CTGCAGAGGGTGACTGCGGGAGG + Intronic
968460057 4:720311-720333 CTGGGGAGGGTGACTGCGGGAGG + Intronic
968533769 4:1111482-1111504 CTGGAGAGGAGCCCAGCGGGAGG - Intronic
968534063 4:1112923-1112945 GGGGAGTGAGGGGCTGCGGGAGG - Intronic
968666229 4:1823688-1823710 CTGGAGAGAGGGTGTCCGGGAGG + Exonic
968886582 4:3337673-3337695 CGGGAGAGGGGGCCTGGGGGAGG + Intronic
969061404 4:4438143-4438165 CGGGAGAAAGGGCCTGCTGGAGG - Intronic
971150496 4:24026300-24026322 CTGGAGAGAGGGTCTATGGCAGG - Intergenic
974000504 4:56506521-56506543 ATGCAAAGAGGGCCTGCGTGTGG - Intronic
977389616 4:96391081-96391103 TTGGAGATGGGGCCTGTGGGAGG + Intergenic
978490164 4:109303157-109303179 ATGGAGAAATGGCCTCCGGGAGG + Intergenic
980234023 4:130080441-130080463 GTGGAGAGAGGGAATGCAGGAGG - Intergenic
980646650 4:135651829-135651851 CTGGAGAGAGGGCCTGTAATGGG - Intergenic
980970251 4:139560575-139560597 CTGGAGGGAGGGGCTGGGAGAGG + Intronic
983012362 4:162563420-162563442 TTGGAAAGAGGGCCTGAGGCAGG + Intergenic
985064177 4:186105140-186105162 CTGGAGGAGGGGCCTGCGGGGGG - Intronic
985129027 4:186723632-186723654 CTGGGGCGCGGGCCGGCGGGCGG - Intronic
985672261 5:1213051-1213073 CGGGAGGCAGGGCCTGCGGGCGG - Intronic
985863882 5:2496188-2496210 CTGGAGGTGGGGCCTGCAGGAGG + Intergenic
985988062 5:3533844-3533866 ATGGCATGAGGGCCTGCGGGAGG - Intergenic
986151142 5:5131388-5131410 CAGGAGAGGGGGCCTGAGTGAGG - Intergenic
986330322 5:6712913-6712935 CAGGAGGGAGGGCCGGCCGGCGG + Intergenic
986370498 5:7075460-7075482 CAGGAGTGAGGGCCTGGGGCAGG - Intergenic
986462723 5:7989645-7989667 CAGGAGAGAGCACCTACGGGAGG + Intergenic
987173090 5:15279152-15279174 CTGGAGGTAGGGCCTGTAGGAGG + Intergenic
990146105 5:52762021-52762043 CTGGAGATTGGGCCTTTGGGAGG + Intergenic
990860721 5:60323768-60323790 CAGGAGAGAGAGGCTGCGGGTGG - Intronic
991644244 5:68785702-68785724 CTGGAGATAGGACCTTAGGGAGG - Intergenic
993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG + Intergenic
994107302 5:95961688-95961710 GGGGACAGGGGGCCTGCGGGAGG - Exonic
995536148 5:113138359-113138381 TTGGAGACAGGGCCTTTGGGAGG + Intronic
996056190 5:118985223-118985245 CTGAGGAGAGGGCTTGAGGGAGG - Intronic
997590533 5:135069374-135069396 ATGCAGAGAAGGCCTGCGTGGGG + Intronic
997847917 5:137304728-137304750 CTGTAGAGAGGCCCTTCTGGTGG - Intronic
998040881 5:138950416-138950438 TGGGAGAGAAGGCCTGGGGGAGG + Intronic
998046549 5:138991552-138991574 CTGGATAGAAGGCCTGCTGGGGG - Intronic
998250500 5:140549010-140549032 TTGGAGAGAGGGGCTGTTGGAGG - Exonic
998460668 5:142307751-142307773 CTGGAGAGAGGGGCAGCCGCTGG - Intergenic
998517582 5:142770227-142770249 CTGGAGGCAGGGTCTGCGGCTGG - Intergenic
999247367 5:150162285-150162307 CTGGAGGGAGGGCTTCCAGGGGG + Intergenic
1000502481 5:162068533-162068555 CTGGGGGGAGGGGCGGCGGGCGG + Intronic
1001135466 5:169099093-169099115 CTGGGGAGAGGGGCTGGGGTAGG - Intronic
1001246916 5:170111678-170111700 CCGGAGAGAGGGACAGAGGGAGG + Intergenic
1001955047 5:175843222-175843244 CTCGAGAGAGGGGCTGGAGGAGG - Intronic
1002045855 5:176541584-176541606 CTGCAGAGGAGGCCTGGGGGAGG - Intergenic
1002103658 5:176869470-176869492 TGGGAGAGAAGGCCTGGGGGAGG - Intronic
1002176376 5:177403605-177403627 CTCGGGTGCGGGCCTGCGGGGGG + Exonic
1002290391 5:178196462-178196484 CTGGAGAGAGAATCTGCTGGCGG - Intergenic
1002458270 5:179358468-179358490 CTGGAGACAGGGCTTTTGGGAGG + Intergenic
1003062804 6:2875993-2876015 CTGGGGAGGCGGCCTGGGGGAGG - Intergenic
1003142183 6:3480893-3480915 CTGGAGATAGGGTCTTCAGGAGG - Intergenic
1003492982 6:6640104-6640126 CTGGTTAGAGGGCATGCAGGTGG - Intronic
1003673383 6:8180565-8180587 CTGGAGAGAGAACTTGGGGGTGG + Intergenic
1004813468 6:19286593-19286615 CTGGTGACAGGGGCTGGGGGAGG + Intergenic
1006067737 6:31474495-31474517 CTGGAGAGAGTGGCTCCTGGTGG + Intergenic
1006133883 6:31884247-31884269 GTGGGGAGGGGGCCTGTGGGTGG + Intronic
1006393324 6:33771625-33771647 CTGGCGGGAGGGCCGGTGGGCGG + Exonic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1007086782 6:39153733-39153755 CTGAAGAGAGAGCATGCTGGTGG - Intergenic
1007122317 6:39393214-39393236 AGGGAGAGAGGGCCTGCGGGTGG - Intronic
1007167866 6:39841249-39841271 CTGGGAAGAGGGGCTCCGGGGGG + Intronic
1007293913 6:40806698-40806720 CTGCACAGAGGGCCTGGGGTGGG + Intergenic
1007301691 6:40872465-40872487 GTGGAGAGGGGGCTTGGGGGAGG - Intergenic
1008165398 6:48132153-48132175 TTGGAGATAGGGCCTTTGGGAGG - Intergenic
1008730477 6:54476129-54476151 TTGGAGAGAGGGCTTTGGGGAGG + Intergenic
1010385087 6:75270408-75270430 CTGGAGAAGGGGCCTTTGGGAGG + Intronic
1012413246 6:98984211-98984233 TTGGAGATAGGGCCTGTGGAAGG + Intergenic
1013954299 6:115822660-115822682 CTGGAGAGAGGGCTGGGTGGAGG + Intergenic
1014492125 6:122075530-122075552 CTGGAGGGAAGGACTGGGGGTGG + Intergenic
1016543620 6:145195466-145195488 TTGGAGGAAGGGCCTGAGGGAGG - Intergenic
1017205489 6:151800480-151800502 CTGGAGATAGGGTCTTTGGGAGG + Intronic
1017237293 6:152130006-152130028 CGGGAGTGAGGGGCTGCTGGAGG + Intronic
1017720487 6:157240263-157240285 CTGGAGAGAGGCCTCGAGGGCGG + Intergenic
1018933898 6:168260813-168260835 CTGGAGAGGCCGCCTGCGTGGGG + Intergenic
1019211464 6:170408738-170408760 CTGGAGAGACGGCCTTAGGTAGG - Intergenic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1019738650 7:2662330-2662352 ACGGAGAGAGGCCCTGCTGGAGG - Exonic
1020082846 7:5296025-5296047 CGGGAGGGAGGGCCTTGGGGTGG - Intronic
1020212901 7:6168965-6168987 CTAGAGTGAGGGCCGGTGGGGGG - Intronic
1020479989 7:8647246-8647268 CTGGGGAGAGAGCCTCTGGGTGG - Intronic
1021114295 7:16730919-16730941 CTGGAGATGGGGCCTTTGGGAGG + Intergenic
1021452971 7:20798616-20798638 CTGGGGCGAAGGCCAGCGGGCGG + Intergenic
1021828140 7:24574034-24574056 ATGGAGAGCCGGCCTGGGGGCGG + Intronic
1022474533 7:30701346-30701368 CTGGAGGAAGGGGCTGAGGGTGG - Intronic
1023048187 7:36229628-36229650 TTGGAGAGAGCGGCTGCAGGGGG - Intronic
1023836026 7:44067662-44067684 CTGGATGGAGGCCCTGAGGGTGG - Intronic
1023842240 7:44104236-44104258 GTGGACGGAGGGGCTGCGGGGGG - Intergenic
1024064328 7:45720008-45720030 CTGTAGAGAGAGCCTCAGGGCGG + Exonic
1025618220 7:63142980-63143002 GTGGAGAGGGGACCTGGGGGTGG - Intergenic
1025778990 7:64582688-64582710 CTGGAGAGTGGCGCTGCGAGTGG + Intergenic
1026661792 7:72309171-72309193 CTGGAGGGAGGCTCTACGGGAGG + Intronic
1026899273 7:74028076-74028098 AGGGAGAGAGGGCGGGCGGGAGG - Intronic
1027794160 7:82671294-82671316 GTGAAGACAGGGCCTTCGGGAGG - Intergenic
1029113228 7:98223935-98223957 CTGCAGGGAGGGCCTCCTGGGGG + Intronic
1030038249 7:105426523-105426545 TTGGAGAGAGTGGCTGCGTGTGG + Intergenic
1031482465 7:122295589-122295611 TTGGAGATAGGGCCTCTGGGAGG + Intergenic
1031975112 7:128088814-128088836 CTGGAGCAAGGTCCTGCTGGAGG + Intronic
1032351404 7:131167052-131167074 CTGGAGAGAGGGGATGTGGCGGG - Intronic
1032530782 7:132617981-132618003 CTGGAAAGTGGGCCTGGAGGTGG - Intronic
1033014827 7:137661474-137661496 CTGGGGAAAGGGCCAGAGGGGGG + Intronic
1033404001 7:141054440-141054462 TTGGAGATAGGGTCTTCGGGAGG - Intergenic
1033600927 7:142888005-142888027 CTGGGGAGAGAGGCTGGGGGAGG + Intergenic
1034093685 7:148387026-148387048 CTGGAGAGAGGACTTACGGTAGG + Intronic
1034776126 7:153828284-153828306 CAGGAGAGAGGGCTTGTGGTGGG + Intergenic
1035577339 8:716231-716253 CTGGAGAGAGGGTCAGCTGATGG - Intronic
1036033398 8:4994783-4994805 CTGGAGAGAGAGCCAGCGAGTGG + Exonic
1036967731 8:13319449-13319471 CTGGAGGAGGGGCCTGCTGGCGG + Intronic
1037690008 8:21173559-21173581 TAGGAGAGAGGGCCTTTGGGAGG + Intergenic
1037699781 8:21263787-21263809 CTGGACAGAGGGCCTTCGACAGG - Intergenic
1038399776 8:27274685-27274707 CAGAAGAGAGGGGCTGGGGGAGG - Intergenic
1039413581 8:37375457-37375479 GAGGAGAGGGGGCCTGGGGGTGG - Intergenic
1039451134 8:37675762-37675784 CTGCAGAAAGGGCCTGGAGGAGG + Intergenic
1040560621 8:48520494-48520516 CTGGTGAGATGGCTTTCGGGTGG + Intergenic
1041313162 8:56536838-56536860 TTGGAGATGGGGCCTTCGGGAGG - Intergenic
1042138990 8:65660554-65660576 CTGATGAGAAGGCCTGAGGGAGG - Intronic
1042167547 8:65960186-65960208 ATGCAGAGAGGCCCTGGGGGAGG + Intergenic
1042217034 8:66437550-66437572 CAAGACAGAGGGCCTGGGGGAGG - Intronic
1042696012 8:71556310-71556332 CTGCAGATGAGGCCTGCGGGTGG + Intronic
1042965821 8:74350697-74350719 CTGGAGGGAGCGCCTGCCCGGGG - Intronic
1042993758 8:74669933-74669955 CTGGAGACAGGGCCTTTAGGAGG + Intronic
1043532066 8:81161779-81161801 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1044357616 8:91242520-91242542 CTAGAGACAGGGCCTCTGGGAGG + Intronic
1044745445 8:95366427-95366449 TTGGAGATAGGGCCTTTGGGTGG - Intergenic
1045296007 8:100872159-100872181 CTGGAGAAGGGGGCTGGGGGTGG - Intergenic
1046504192 8:115115904-115115926 CTGGAGAGAGGAGATGGGGGTGG - Intergenic
1046658164 8:116919600-116919622 CTGGAGGGTGGGACTGGGGGAGG + Intergenic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1048078386 8:131098083-131098105 AGGGAGAGAGGGCCTGGAGGAGG + Intergenic
1048150053 8:131885431-131885453 CTGGAGGGAGAGGCTGCTGGGGG - Intergenic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1048360636 8:133694310-133694332 TGGGACAGAGGGCCTGGGGGAGG + Intergenic
1048655056 8:136526823-136526845 TTGGAGACAGGGCCTTTGGGAGG - Intergenic
1048833106 8:138495711-138495733 CTGGAGAGAGGGCCAGAGCTTGG - Intronic
1048981639 8:139705708-139705730 CTGGGGAGAGTGCCTGCTCGGGG - Intergenic
1049041357 8:140114242-140114264 CTGGATATATGGCCTGGGGGTGG - Intronic
1049120774 8:140735217-140735239 CGGGAGAGAGGGCCTGGGGGTGG - Intronic
1049629732 8:143647109-143647131 CAGGAGAGAGGGCATGCTGAGGG + Intronic
1049702942 8:144023279-144023301 CAGGAGAGAGGTCCTGAGGTGGG - Intronic
1050085441 9:1960164-1960186 CTGGATAGAGGGGCTCAGGGTGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051774915 9:20622549-20622571 GCGGAGGGAGGGCTTGCGGGCGG + Intergenic
1052807542 9:33025746-33025768 CAGGGGCGAGGGGCTGCGGGGGG + Intronic
1053200835 9:36150661-36150683 CTGAAGAGTGGGCCTTCTGGGGG - Intronic
1053295041 9:36906687-36906709 CTGGTGGGAGAGCTTGCGGGGGG - Intronic
1054961583 9:70975992-70976014 ATGGAGATAGGGGCTGGGGGAGG - Intronic
1055280737 9:74671185-74671207 AGGGAGAGAGGGTCTGAGGGAGG + Intronic
1055880187 9:80991635-80991657 CTGGAGAGAGGGTCTTTAGGAGG - Intergenic
1056546752 9:87620128-87620150 CTGGGGAGAGGGCCAGGGAGAGG - Intronic
1056761106 9:89415502-89415524 CTGGAGAGGGAGCCTTTGGGAGG + Intronic
1056942245 9:90965519-90965541 CTGGAAGGAGGGCCTGCCAGGGG + Intergenic
1057083216 9:92188170-92188192 CTGAAGAGAAGCCCTGCAGGTGG + Intergenic
1057215204 9:93224106-93224128 CTGGAGCGAGGCCCTGCAGCAGG + Intronic
1057335112 9:94149361-94149383 CTGGAGAGTGGGACTAGGGGTGG - Intergenic
1057521507 9:95764101-95764123 CTGGGGAGAGGGCTTGTGGGAGG + Intergenic
1057745653 9:97748827-97748849 CTGGAGAGATGGCCTTGGGAAGG - Intergenic
1058906149 9:109484208-109484230 CTGGACAGAGGGACTGCTGTGGG - Intronic
1059387392 9:113975126-113975148 TTGGAGAGAGGGCTGGAGGGAGG + Intronic
1059419800 9:114183769-114183791 CTGGAGACAGAGCCAGGGGGAGG + Intronic
1060277296 9:122191858-122191880 ATGGAGGGGGAGCCTGCGGGAGG - Intronic
1060657368 9:125381124-125381146 CTGGAGAGCAGGCCAGCTGGGGG + Intergenic
1060819078 9:126651283-126651305 CTGGAAGGAGGGACTGGGGGGGG + Intronic
1060908409 9:127328959-127328981 CTGGAGGGAGGTGCTGCTGGAGG - Intronic
1060980778 9:127790428-127790450 CTGGGTAGAGGGCCTGGGGCAGG + Exonic
1061341353 9:129984549-129984571 CTGGAAAGTGGACCTCCGGGGGG - Intronic
1061396492 9:130346582-130346604 CTGGGGTTAGGGCCTGTGGGAGG - Intronic
1061728795 9:132597300-132597322 CGGGAGACAGGGCCTGCGGTTGG + Intronic
1061791857 9:133063273-133063295 CTGGCCAGAGGGCCTCAGGGTGG - Intronic
1061838174 9:133342709-133342731 GTGGACAGGAGGCCTGCGGGAGG + Intronic
1062030109 9:134358381-134358403 CTGGAGGGAGGGCTTCCTGGGGG + Intronic
1062689149 9:137832517-137832539 GTGGGGGGAGGGCCTGCGGAGGG - Intronic
1062710433 9:137972378-137972400 CTGGAGACAGGGCCTGTTTGGGG + Intronic
1185736941 X:2501748-2501770 CTGGAGAGGGGTCCTGGTGGTGG - Intronic
1186575989 X:10766346-10766368 CTGGAGGGTGGGGCTGGGGGTGG + Intronic
1186899056 X:14033508-14033530 CTGAAGCGAGGGCCTGCTAGGGG - Intergenic
1189114272 X:38327286-38327308 CGGGAGGGAGGGTCCGCGGGCGG - Intronic
1189339926 X:40197164-40197186 CTGGAGCAAGGGCCTGGGGCTGG - Intergenic
1190179255 X:48177598-48177620 CTGCAGATAGGGCCTGCGTGAGG + Intergenic
1190304113 X:49072770-49072792 CTGGAGATAGGGCTGGTGGGAGG - Intronic
1190486162 X:50927261-50927283 CTGGAGACTGGGTCTGAGGGGGG + Intergenic
1191846379 X:65550685-65550707 CTGCAGAGGGGCCCTGTGGGAGG + Intergenic
1193221764 X:78934970-78934992 ATGGAGGAAGGGGCTGCGGGAGG + Intergenic
1199948816 X:152689104-152689126 CTGGAGATGGGGCCTTTGGGAGG + Intergenic
1199960860 X:152779346-152779368 CTGGAGATGGGGCCTTTGGGAGG - Intergenic