ID: 1048295914

View in Genome Browser
Species Human (GRCh38)
Location 8:133213087-133213109
Sequence GCCTCTACTGTGACTACAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048295907_1048295914 -2 Left 1048295907 8:133213066-133213088 CCATCTGTGACCCCCACCGGGGC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG 0: 1
1: 0
2: 1
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048295914 Original CRISPR GCCTCTACTGTGACTACAGC GGG Exonic
900878912 1:5366477-5366499 CCCTTTGCTGTGACCACAGCAGG + Intergenic
902364802 1:15965576-15965598 GCCTCTCCAGGGACTGCAGCTGG - Intronic
903752678 1:25636813-25636835 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
906130197 1:43451296-43451318 CCCTCTACTGTGTCTCCTGCAGG + Exonic
906665073 1:47615716-47615738 GGCTCAACTCTGAATACAGCAGG + Intergenic
907871621 1:58448839-58448861 GCCTTGGCTGTGAGTACAGCAGG + Intronic
908633837 1:66139825-66139847 ACCTCTTCTCTGACTAGAGCTGG - Intronic
909211524 1:72830771-72830793 GCCTTTACTGTGGCTATAGTAGG + Intergenic
911426699 1:97724438-97724460 GGCTCTTCTGTGTCTCCAGCTGG - Intronic
912988368 1:114457784-114457806 GCCACCACTGTGATTACAGAAGG + Intronic
918582891 1:186152851-186152873 ACCTTTACAGTGACTTCAGCAGG - Exonic
920204786 1:204283559-204283581 ACCTCTCCTGTCACTATAGCTGG - Intronic
920230286 1:204465709-204465731 CCCTCTACTGAGGCTAGAGCAGG + Intronic
920858915 1:209689011-209689033 GCCTCTACAGCTACTCCAGCTGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923898505 1:238299969-238299991 GCCTCTGCTTTGACTCCAACAGG + Intergenic
924516077 1:244767639-244767661 ACCACTACTGTGACTGCACCAGG + Intergenic
1063381406 10:5588480-5588502 GCCTTTATTCTGACTACAGGGGG - Intergenic
1064523033 10:16223524-16223546 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1068705984 10:60075989-60076011 ACCTCTCCAGTGACTACAGCAGG - Exonic
1069570085 10:69489526-69489548 TCCTCTGCTGTGGCTGCAGCTGG + Intronic
1070640238 10:78163173-78163195 GCCTCTTCTATCACTGCAGCAGG - Intergenic
1071269738 10:83995934-83995956 CCCTTCACTGTGACTACAGATGG + Intergenic
1074285422 10:112093321-112093343 GGCTGTAGGGTGACTACAGCGGG - Intergenic
1076197023 10:128526163-128526185 CCCTCTCCTGTGTCTTCAGCGGG + Intergenic
1076661229 10:132057188-132057210 GCCACTACTGTGGCAACATCTGG + Intergenic
1078714737 11:13829066-13829088 GCCTCTACTGTTATTTCTGCAGG - Intergenic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1087681350 11:101221326-101221348 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1090592022 11:128282219-128282241 GCCCCTTTTGTGACTTCAGCTGG - Intergenic
1091357546 11:134949200-134949222 ACCTCTCCAGTGACTGCAGCGGG - Intergenic
1094681501 12:32671397-32671419 GTCTCTACTGAAAATACAGCCGG + Intergenic
1097247237 12:57613279-57613301 TCCTCTCCTGTGGCTAGAGCTGG - Exonic
1097383959 12:58927277-58927299 GGCACAACTGTGACTACAGCAGG + Intergenic
1098935498 12:76474070-76474092 GCCTATACTGTGTTTAGAGCAGG - Intronic
1100087571 12:90930305-90930327 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1100970521 12:100065073-100065095 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1101880246 12:108621456-108621478 GGCTCAACTATGAGTACAGCAGG - Intergenic
1103333839 12:120174263-120174285 ACCTCTTCTGTGTCTCCAGCAGG + Intronic
1104814334 12:131637308-131637330 GCCTCTCCTGAGTCTACAGTTGG - Intergenic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105897809 13:24732203-24732225 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1107103796 13:36622494-36622516 GCCTCTGCTGTAGCTACTGCAGG - Intergenic
1110953621 13:81524628-81524650 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
1111427214 13:88102747-88102769 GTCTCTATTCTGAATACAGCAGG + Intergenic
1113149304 13:107243799-107243821 GCCTCTGCTGTGGCTACAGGAGG + Intronic
1113738720 13:112696660-112696682 GTCTCTTCTGTGCCTACCGCGGG + Intronic
1115456410 14:33609000-33609022 GTCTCTTCTGAGACTACAGTGGG + Intronic
1117081030 14:52151915-52151937 GCCTCTATTGTCTCTACAGCAGG + Intergenic
1117701166 14:58415000-58415022 GCCTCCACTGACATTACAGCAGG - Intronic
1118216403 14:63812704-63812726 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1118721946 14:68600568-68600590 CCCTCTACTGTGGCCCCAGCGGG - Intronic
1123858458 15:24437493-24437515 CCCACTACCGTGACTGCAGCTGG - Intergenic
1126805132 15:52340360-52340382 TCCTCTTCTGTGACTGCAGCTGG + Exonic
1128595197 15:68939444-68939466 GCCTCAACTGTCCCTACAGATGG - Intronic
1129101240 15:73266094-73266116 TCCTCTACTGAGACTAAATCCGG + Intronic
1131093600 15:89642015-89642037 GCCTCTACTGTGTGTAAAGCTGG + Intronic
1131645339 15:94336290-94336312 GCCTCCACTGGCACTCCAGCTGG + Intronic
1132898241 16:2238897-2238919 GCCTGTACTGTGAGCACAGCTGG + Intergenic
1138011402 16:53384200-53384222 TCTTCTGCTGTGACTTCAGCTGG - Intergenic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1144588249 17:16502020-16502042 GGCTCAACTCTGAATACAGCTGG - Intergenic
1144673699 17:17147405-17147427 GCCTCTGCTGTGGAGACAGCTGG + Intronic
1146609497 17:34291693-34291715 GCCTTAACTGTGCCTTCAGCAGG + Intergenic
1152718012 17:81909113-81909135 CCCTCTTGTGTGGCTACAGCTGG - Intronic
1152915319 17:83031687-83031709 GGCTCCACTCTGACTGCAGCAGG + Intronic
1153817110 18:8800109-8800131 AGCTCTACTGTAACGACAGCTGG + Intronic
1153828793 18:8901191-8901213 TCCTCTACTATTACTGCAGCTGG + Intergenic
1153994211 18:10425712-10425734 CCCTTTACTATGACTACAGCGGG + Intergenic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1154444584 18:14424695-14424717 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1158532278 18:58274199-58274221 GCCTCTTATGTGACTATAGTTGG - Intronic
1159513755 18:69431039-69431061 GCCTCCACTGTGACAAAATCAGG + Intronic
1160034209 18:75286213-75286235 GCCACTACCGTGACGACAACAGG + Exonic
1160307110 18:77750209-77750231 GCCTCTTCAGTGGTTACAGCTGG + Intergenic
1162626331 19:11887928-11887950 ACACCTCCTGTGACTACAGCAGG - Exonic
1162630734 19:11925215-11925237 ACAGCTCCTGTGACTACAGCAGG - Exonic
1163941699 19:20501173-20501195 TCCTCTGCTGCGACTCCAGCTGG + Intergenic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164289848 19:23857383-23857405 TCCTCTACCGTGGCTCCAGCCGG + Intergenic
1164602694 19:29573704-29573726 GCCGGTACAGTGACCACAGCTGG - Intergenic
1165059418 19:33197801-33197823 GCCTCCCCTTTGACCACAGCAGG - Intronic
1165271677 19:34713053-34713075 GCCCATACTGTGCCAACAGCAGG + Intergenic
1165480243 19:36059076-36059098 GCCTTTATTATGACTACAGGGGG + Intronic
1165642136 19:37398668-37398690 GCCTCTGCTGTGGCTCAAGCTGG - Intergenic
1166104833 19:40592444-40592466 GCCTCTACTAAAAATACAGCAGG - Intergenic
928213337 2:29340280-29340302 GCTACTACTGAGACTACTGCAGG + Intronic
928819453 2:35342988-35343010 GCATCTAGTGTGCCTGCAGCAGG + Intergenic
929907236 2:46056968-46056990 GCCTCTTGTGTGGCTACAGAGGG + Intronic
930640950 2:53854020-53854042 GCATCGACTGTGATTACAGGGGG + Exonic
932395518 2:71444468-71444490 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
936010430 2:108921846-108921868 GCCTCTAATGGGAACACAGCAGG + Intronic
937152243 2:119693777-119693799 GTGTCTTCTGTGACTGCAGCTGG - Intergenic
937371081 2:121297689-121297711 GCCTTTTCTGTGAATGCAGCAGG + Intergenic
947254742 2:228149583-228149605 TCCTCTTCTGTGACTACAGATGG - Intronic
948852901 2:240717179-240717201 GCCTCTGCTGGGAGCACAGCTGG + Exonic
1169960610 20:11155523-11155545 GCCTCTACTGTGTGTACAGATGG + Intergenic
1171003029 20:21433893-21433915 GCCTCTCCTCTGACCCCAGCTGG - Intergenic
1173547582 20:43910768-43910790 GCCTTTACTGTGGCTTCCGCAGG - Intergenic
1174904622 20:54537234-54537256 GCCTCTAATGTTGCTACAACAGG - Intronic
1178782473 21:35617163-35617185 GCCTCCACTGATAATACAGCAGG + Intronic
1179164592 21:38925648-38925670 TCCTCTGCTGGGAATACAGCAGG - Intergenic
1179292620 21:40031879-40031901 GTCTCTACTGTGAGAGCAGCAGG - Intronic
1180022682 21:45138638-45138660 GTCTCTTTTGTGACTAAAGCTGG - Intronic
1181622718 22:24102067-24102089 GGCTATACCCTGACTACAGCAGG - Intronic
1182690623 22:32159153-32159175 GCCTCAACTGTGACTGCTGCAGG - Exonic
1182925225 22:34116180-34116202 GCCTCAACTGTGACCACTTCTGG + Intergenic
1183839369 22:40485395-40485417 GCCTGAACTGTGGCAACAGCTGG + Intronic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
953846519 3:46431576-46431598 TCCTCTGCTGTGGCTCCAGCTGG - Intergenic
954695515 3:52422866-52422888 GCCTCACCTGTGGCTGCAGCAGG - Exonic
958424336 3:93963947-93963969 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
958497504 3:94864019-94864041 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
959022304 3:101201215-101201237 ACTTCTACTGTGATTACAGGTGG - Intergenic
961524776 3:127489753-127489775 GCCTCCACTGTGACTGCATTTGG + Intergenic
962275314 3:134008891-134008913 GACTCAACTGTGACAACAGATGG + Intronic
962580165 3:136790936-136790958 GCCTCTGCTTTGATTAAAGCAGG + Intergenic
970894251 4:21084071-21084093 GCTTCTGCTGTGGCTCCAGCAGG + Intronic
973659159 4:53084633-53084655 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
975162146 4:71136280-71136302 GGCTCTTCTGTAACTACATCAGG - Intergenic
978185332 4:105850563-105850585 GCCTCTACTGGGAACATAGCTGG + Intronic
979974377 4:127178424-127178446 CCCTCTGCTGTGATTATAGCAGG - Intergenic
983303471 4:165956831-165956853 TCCTCTGCTGTGGCTCCAGCCGG + Intronic
985089744 4:186350758-186350780 GCCTCCACTGTCACTTCATCTGG + Intergenic
985362441 4:189190026-189190048 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
987086390 5:14473085-14473107 GCCTGTACTGTGGCTGCACCAGG + Intronic
988553872 5:32220140-32220162 GCCTCAGCTGGGACTACAGGCGG + Intergenic
991264045 5:64696039-64696061 TCCTCTGCTGTGGCTCCAGCCGG - Intronic
993048217 5:82893210-82893232 GCCTCGTCTGTGTCTACAGCAGG - Intergenic
995187466 5:109287269-109287291 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
999918954 5:156296633-156296655 GTATCTTCTGTGACTACAACAGG - Intronic
1010776455 6:79891721-79891743 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1010816663 6:80365833-80365855 TCCTCTGCTGTGGCTCCAGCCGG + Intergenic
1011926310 6:92649667-92649689 GACTCAACTCTGACTCCAGCAGG - Intergenic
1012769410 6:103410233-103410255 CTCTCTACTGTGAGTAGAGCAGG + Intergenic
1018102209 6:160450759-160450781 TCCTCTGCTGTGGCTCCAGCTGG + Intronic
1021176858 7:17459536-17459558 ACCTCTGCTGTGGCTCCAGCCGG + Intergenic
1022796442 7:33735174-33735196 GCCTCATTTGTGACTCCAGCGGG + Intergenic
1024498423 7:50072556-50072578 ACCACTACTGTGACTACACTGGG - Intronic
1025743807 7:64225522-64225544 TCCTCTACTGCGGCTCCAGCTGG + Intronic
1034974345 7:155439193-155439215 GCCTGTCCTGTGGCCACAGCTGG - Intergenic
1035748305 8:1977444-1977466 GCCTCTCCAGAGACTACTGCAGG - Intronic
1036728729 8:11243247-11243269 GCCTTTACTGTGACTTCTGCAGG + Intergenic
1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG + Intergenic
1037793409 8:21968573-21968595 GACTGTACTGTCACTCCAGCAGG - Intronic
1040059531 8:43092705-43092727 GACTCTACTGTAACGACAGGAGG + Intergenic
1040926351 8:52687947-52687969 TCCTCTGCTGTGGCTCCAGCTGG - Intronic
1042191440 8:66191632-66191654 TCCTCTGCTGTGGCTCCAGCTGG + Intergenic
1046407297 8:113790949-113790971 GACTCTTCTCTGACGACAGCTGG - Intergenic
1046422919 8:114008172-114008194 GCCTCTCCTGGGACTACCGACGG + Intergenic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1049037084 8:140085189-140085211 GTCACTCCTGTAACTACAGCAGG - Intronic
1050003129 9:1099556-1099578 GCCTCTTCTGTGACTTCTGCTGG + Intergenic
1062547772 9:137071293-137071315 GCCTCTGCTGTGTTTCCAGCTGG + Intergenic
1062604410 9:137338988-137339010 GGCTCTGCTGTGTCTGCAGCTGG - Intronic
1189784084 X:44543574-44543596 GTCTCAACTCTGAATACAGCAGG - Intergenic
1189974645 X:46448697-46448719 GCCTTTACAGGCACTACAGCAGG - Intronic
1200725277 Y:6662640-6662662 TCCTCTGCTGTGGCTCCAGCCGG - Intergenic