ID: 1048298284

View in Genome Browser
Species Human (GRCh38)
Location 8:133232543-133232565
Sequence AAACCCAGCTTCTCTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048298282_1048298284 28 Left 1048298282 8:133232492-133232514 CCCTTAAATTTTTGCTTTTTATG No data
Right 1048298284 8:133232543-133232565 AAACCCAGCTTCTCTAAAGCAGG No data
1048298283_1048298284 27 Left 1048298283 8:133232493-133232515 CCTTAAATTTTTGCTTTTTATGT No data
Right 1048298284 8:133232543-133232565 AAACCCAGCTTCTCTAAAGCAGG No data
1048298281_1048298284 29 Left 1048298281 8:133232491-133232513 CCCCTTAAATTTTTGCTTTTTAT No data
Right 1048298284 8:133232543-133232565 AAACCCAGCTTCTCTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048298284 Original CRISPR AAACCCAGCTTCTCTAAAGC AGG Intergenic
No off target data available for this crispr