ID: 1048299188

View in Genome Browser
Species Human (GRCh38)
Location 8:133238979-133239001
Sequence TGCGGGTGCCCTCGCTGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048299180_1048299188 1 Left 1048299180 8:133238955-133238977 CCCCCTCGCTGGTGTGCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 42
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299173_1048299188 29 Left 1048299173 8:133238927-133238949 CCCGAGTTGGGGGTGATGTCCAG 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299183_1048299188 -1 Left 1048299183 8:133238957-133238979 CCCTCGCTGGTGTGCGAGCGGCT 0: 1
1: 2
2: 0
3: 3
4: 32
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299174_1048299188 28 Left 1048299174 8:133238928-133238950 CCGAGTTGGGGGTGATGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299179_1048299188 10 Left 1048299179 8:133238946-133238968 CCAGGTGGGCCCCCTCGCTGGTG 0: 1
1: 0
2: 0
3: 14
4: 147
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299184_1048299188 -2 Left 1048299184 8:133238958-133238980 CCTCGCTGGTGTGCGAGCGGCTG 0: 1
1: 1
2: 1
3: 4
4: 90
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98
1048299182_1048299188 0 Left 1048299182 8:133238956-133238978 CCCCTCGCTGGTGTGCGAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048299188 Original CRISPR TGCGGGTGCCCTCGCTGGTG TGG Exonic
900309087 1:2024799-2024821 TGTGGGAGCCCTTGCAGGTGGGG - Intronic
900429417 1:2594768-2594790 TGTGAGTGGCATCGCTGGTGCGG - Exonic
901063977 1:6486040-6486062 TGGGGGTGCCCACTCTGCTGTGG + Intronic
901844738 1:11974757-11974779 AGCGGGTGCCCCTGGTGGTGGGG - Exonic
904401212 1:30257919-30257941 TGCAGGTGCCCGGGCTCGTGGGG - Intergenic
907329796 1:53663509-53663531 GGAGGGTGCCCCAGCTGGTGGGG - Intronic
920385650 1:205568929-205568951 GGCGGGGCCCCTCGCTGGGGCGG + Intronic
922725350 1:227920534-227920556 TGCGGGTGCCCAGGCTCGGGGGG - Exonic
924707010 1:246509887-246509909 TGCAGGTGCCCATGCTGCTGTGG + Intergenic
1064262020 10:13793609-13793631 TGCAGGTGCCATGGCTGGAGTGG + Intronic
1067815978 10:49477121-49477143 TGCGGGTGGCTTGGGTGGTGAGG - Intronic
1071776391 10:88792914-88792936 TGCGGTTTCCCTGGCTGGTGTGG - Intergenic
1076266360 10:129112433-129112455 TGCCCTTGCCCCCGCTGGTGAGG - Intergenic
1077076443 11:704516-704538 TGCGAGTGCAGGCGCTGGTGAGG - Intronic
1080458638 11:32435668-32435690 TGGGGGCGCCCTCGCAGCTGGGG + Intergenic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1085529803 11:77184520-77184542 TGCTGGTGCCCTGGCTGGCAGGG + Intronic
1089304175 11:117516435-117516457 GGCAGGGGCCCTGGCTGGTGAGG + Intronic
1090400053 11:126443273-126443295 TCCGAGTGCCCTGGCTGGCGCGG + Intronic
1093643551 12:21555852-21555874 TCTGGGTCCCCTTGCTGGTGGGG - Intronic
1095981121 12:47975374-47975396 TGCGGGAGCCCTCGGGGCTGCGG + Exonic
1096180718 12:49549091-49549113 TGCCGAAGCCCACGCTGGTGAGG - Exonic
1113462857 13:110493852-110493874 AGCGGGTGCTCTCCCTCGTGAGG - Intronic
1113817107 13:113180029-113180051 GCAGGTTGCCCTCGCTGGTGAGG + Exonic
1113838481 13:113345471-113345493 TGGGGCTGCCCTCGATGGAGAGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1122205717 14:100146952-100146974 TGCGTGTGTGCTCGCGGGTGCGG - Intronic
1125506935 15:40272484-40272506 CAAGGGTGCCCTGGCTGGTGAGG + Exonic
1129187889 15:73921634-73921656 AGTGGGTGCCCAGGCTGGTGGGG - Intergenic
1129728132 15:77913393-77913415 TGCGTGTGCGCTCCCTGGGGTGG - Intergenic
1137610226 16:49813008-49813030 TGTGGGTGCCCCTGGTGGTGTGG - Intronic
1139806325 16:69567087-69567109 TGGGGGTGCCCTCTCTGGATTGG + Intronic
1141205862 16:81932733-81932755 CATGGGTGCCCTCGCTGGTGGGG + Intronic
1142153992 16:88524926-88524948 GGTGGGTGCCCTGGCTGGGGTGG - Intronic
1142688387 17:1590991-1591013 TGCGTGTCCCCCCGGTGGTGGGG - Intronic
1142810716 17:2394401-2394423 TGCGGGTGGCGGCGCTGGTCAGG - Intronic
1142851415 17:2706581-2706603 TGGGGGTGCCCTTCCTGGGGCGG - Intronic
1144827719 17:18115753-18115775 TGGGGGTGCACTGGGTGGTGAGG - Intronic
1145796847 17:27660564-27660586 TCCAGGTGCCCTGTCTGGTGGGG + Intergenic
1147611198 17:41802879-41802901 TGCTGCTGCCCAGGCTGGTGAGG + Exonic
1148388593 17:47254058-47254080 TGCGCGTGTCCTGGCTGGCGCGG + Intronic
1150228358 17:63535986-63536008 TGCCGAAGCCCACGCTGGTGAGG - Exonic
1151199777 17:72459197-72459219 TGAGGGTCCCCTCTCTGGAGTGG + Intergenic
1155308075 18:24498598-24498620 TCTGGGTGCCCTCACTGCTGGGG - Intergenic
1160725022 19:614042-614064 GGCGGGTGCCCTGGCGGGGGAGG + Intronic
1163023602 19:14496481-14496503 CTCGGGTGCCCTGGGTGGTGAGG + Intergenic
1163103761 19:15111738-15111760 CTCGGGTGCCCTCAGTGGTGGGG - Exonic
1164843905 19:31415819-31415841 TGCGGCTCCCCTCACTGGTTGGG - Intergenic
1167300119 19:48673160-48673182 TGCGGGTGGCCTGGCTGGCAGGG - Intergenic
1167494454 19:49809438-49809460 TGCTGCTCCCCTGGCTGGTGGGG - Exonic
1167601852 19:50459302-50459324 TGTGGGTGCGCGCGCTGGGGAGG + Exonic
1167638604 19:50668431-50668453 TGCTGCTGCCCTGGCTGCTGCGG + Exonic
1167894285 19:52568806-52568828 GACAGGTGCCCTCTCTGGTGAGG - Intronic
1167915589 19:52737488-52737510 GACAGGTGCCCTCTCTGGTGAGG + Intergenic
1167994784 19:53393635-53393657 TACAGGTGCCCTCTCTGGTGAGG - Intronic
1167999050 19:53430469-53430491 GACAGGTGCCCTCTCTGGTGAGG - Intergenic
927309868 2:21618030-21618052 TGCTGTAGCCCTCGGTGGTGAGG + Intergenic
929584149 2:43102854-43102876 TGCTGGTGGCCTGGCTGTTGGGG - Intergenic
929961229 2:46497793-46497815 TGAGCGTGCCCTGGCTGGTGAGG + Intronic
930873947 2:56193068-56193090 TGCGGGTGCCTTTGCTGTTCGGG - Exonic
932396733 2:71453900-71453922 TGTGGGTCCCCTCGCTGGAGAGG - Intronic
935055917 2:99566615-99566637 TGTGGCTGCCCTTGCTGATGTGG - Intronic
943947834 2:194090474-194090496 TGCGGGAGCCCACCCTGGGGTGG + Intergenic
946125680 2:217560564-217560586 TAAGGGTGCCCTGGCTGATGAGG - Intronic
946422265 2:219571483-219571505 TGCGGGGCCACTCGCTGGAGAGG - Intronic
946495518 2:220192134-220192156 TCCTGGTGCCCTCTCTGGAGAGG + Intergenic
946495726 2:220193380-220193402 TCCTGGTGCCCTCTCTGGAGAGG - Intergenic
1169206061 20:3740937-3740959 GGTGGGTGACCTGGCTGGTGTGG + Intronic
1171426277 20:25050703-25050725 TCCTGGTGCCCTGGCTGCTGTGG - Intronic
1171529665 20:25844710-25844732 TTCGGGTCCCCTCTCTGCTGGGG - Intronic
1171547161 20:26011178-26011200 TTCGGGTCCCCTCTCTGCTGGGG + Intergenic
1172606342 20:36216776-36216798 TGCTGGTGCCCAGGCTGGGGTGG + Intronic
1177404355 21:20646038-20646060 TGTGGGTGTCCTCTCTGCTGAGG + Intergenic
1178843747 21:36157343-36157365 TGCTGGTGCCCTGGCTGGGGAGG + Intronic
1179979815 21:44890056-44890078 TGCCGGGGACGTCGCTGGTGTGG + Exonic
1184890351 22:47375370-47375392 TGCTGGTGGCCTGGCTGCTGGGG - Intergenic
950657992 3:14449173-14449195 GTCGGTTGCCCTCACTGGTGTGG + Intronic
953830954 3:46297293-46297315 TTAGGGTGGCCTCTCTGGTGTGG - Intergenic
957984553 3:87557185-87557207 TGTGGCTGCACTGGCTGGTGTGG - Intergenic
961268813 3:125671955-125671977 TGCAGGAGCCCACGGTGGTGGGG - Intergenic
961569508 3:127787666-127787688 TGAGGGTGTCCTCGCTGGAGGGG + Intronic
968550803 4:1222614-1222636 GGCGGGGGCCCTGGCAGGTGGGG + Intronic
968589050 4:1448698-1448720 TGGGGGTGGCCTGGCTGTTGGGG - Intergenic
969131529 4:4994169-4994191 GGCGGGTGTCCTCACTGCTGTGG - Intergenic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
985607537 5:866129-866151 AGCTGGTCCCCTGGCTGGTGGGG - Intronic
985775347 5:1838225-1838247 GGCAGGTCCCCTCGCTGCTGGGG + Intergenic
990955222 5:61333062-61333084 TGCGGGTGTCCTCACTGGCCCGG + Intronic
994510752 5:100700649-100700671 TGCTGGTGACCTTGCTGGAGAGG - Intergenic
997203359 5:132026310-132026332 TGGTTGTGGCCTCGCTGGTGTGG + Intergenic
1000215588 5:159152708-159152730 TGCTGGTGCTGTTGCTGGTGGGG - Intergenic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1008624143 6:53301200-53301222 TGTGGTTGGCCTCACTGGTGCGG + Intronic
1018608826 6:165626686-165626708 TGCGATTTCCCTCCCTGGTGCGG + Intronic
1018981870 6:168607487-168607509 GGCAGGTGCCCTGGCTGCTGCGG - Intronic
1024723268 7:52162640-52162662 TGCTGGTGCCCTGGCTGCAGGGG - Intergenic
1028402012 7:90434208-90434230 TGCTGGTGCCAACCCTGGTGTGG - Intronic
1032339685 7:131059043-131059065 TGCAGGAGCCCACGGTGGTGGGG - Intergenic
1033313877 7:140282137-140282159 TGGGGGTGATCTGGCTGGTGGGG + Intergenic
1034781921 7:153888450-153888472 GGCGGGTGGGCTCGCTGGGGAGG - Intronic
1035239853 7:157522370-157522392 TGAGCGTGGCCTCACTGGTGCGG + Intergenic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1042562456 8:70082967-70082989 TGCGGCTCCCCTCTCTGCTGAGG + Intergenic
1043278433 8:78431860-78431882 TGGGGATGCCCTCCCTGGTATGG - Intergenic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1048329794 8:133463803-133463825 TGCTGGGGCACTGGCTGGTGAGG + Intronic
1049385639 8:142341658-142341680 CGGGGGTGACCTCGCTGGTGTGG - Intronic
1057929829 9:99184039-99184061 TGTGGGTGCCCTGGCTGGCAGGG - Intergenic
1189362111 X:40360693-40360715 AGCGGGTGCCGCCGCTGATGAGG + Intergenic
1199635520 X:149808455-149808477 TGCTGGTGCCCTCACTGGATTGG - Intergenic