ID: 1048299196

View in Genome Browser
Species Human (GRCh38)
Location 8:133239009-133239031
Sequence TTCGGGTGCCCTCGCTGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048299191_1048299196 -1 Left 1048299191 8:133238987-133239009 CCCTCGCTGGTGTGGGAGCGGCT 0: 2
1: 1
2: 1
3: 7
4: 104
Right 1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 79
1048299183_1048299196 29 Left 1048299183 8:133238957-133238979 CCCTCGCTGGTGTGCGAGCGGCT 0: 1
1: 2
2: 0
3: 3
4: 32
Right 1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 79
1048299182_1048299196 30 Left 1048299182 8:133238956-133238978 CCCCTCGCTGGTGTGCGAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 79
1048299192_1048299196 -2 Left 1048299192 8:133238988-133239010 CCTCGCTGGTGTGGGAGCGGCTT 0: 1
1: 1
2: 1
3: 6
4: 94
Right 1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 79
1048299184_1048299196 28 Left 1048299184 8:133238958-133238980 CCTCGCTGGTGTGCGAGCGGCTG 0: 1
1: 1
2: 1
3: 4
4: 90
Right 1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG 0: 1
1: 1
2: 0
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048299196 Original CRISPR TTCGGGTGCCCTCGCTGGTG TGG Exonic
901075858 1:6554372-6554394 CTCGGGAGCCTGCGCTGGTGCGG - Exonic
901200404 1:7463814-7463836 TTCAGGAGCCCTCTTTGGTGTGG + Intronic
901676058 1:10885858-10885880 TTCGGTTGCCCAGGCTGGAGTGG - Intergenic
901860071 1:12068579-12068601 TTCTCGTGGCCTTGCTGGTGGGG + Intronic
908382450 1:63609458-63609480 TTAGGGTGCTCATGCTGGTGGGG + Intronic
920918828 1:210280762-210280784 TTCGGGACCCCTCTCTGCTGTGG + Intergenic
1071776391 10:88792914-88792936 TGCGGTTTCCCTGGCTGGTGTGG - Intergenic
1075303101 10:121342889-121342911 TTCAGGTGCACTAGCTGGTAGGG + Intergenic
1082783026 11:57301657-57301679 TTCTGGAGCCCTCGATGGAGAGG + Intronic
1083856548 11:65395999-65396021 TCTGTGTGCCCTCGCAGGTGGGG + Intronic
1090400053 11:126443273-126443295 TCCGAGTGCCCTGGCTGGCGCGG + Intronic
1091913383 12:4250179-4250201 ATCATGTGACCTCGCTGGTGTGG - Intergenic
1093643551 12:21555852-21555874 TCTGGGTCCCCTTGCTGGTGGGG - Intronic
1095052613 12:37567686-37567708 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1105239300 13:18595985-18596007 TTCCCCTGCCCTCTCTGGTGGGG - Intergenic
1106328335 13:28716116-28716138 TTCTGCTGCCCACGCTGGAGTGG - Intronic
1113817107 13:113180029-113180051 GCAGGTTGCCCTCGCTGGTGAGG + Exonic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1125506935 15:40272484-40272506 CAAGGGTGCCCTGGCTGGTGAGG + Exonic
1130846110 15:87747777-87747799 ATCGGTTGCCCTCCCTGCTGCGG + Intergenic
1135417368 16:22278810-22278832 TTTGTGTGCCCTGGCTGGTTTGG + Intronic
1141205862 16:81932733-81932755 CATGGGTGCCCTCGCTGGTGGGG + Intronic
1142229806 16:88894937-88894959 TTCCTGTGCCCTGGATGGTGGGG + Intronic
1145796847 17:27660564-27660586 TCCAGGTGCCCTGTCTGGTGGGG + Intergenic
1151348273 17:73516493-73516515 CTCTGGGGCCCTGGCTGGTGAGG - Intronic
1152617871 17:81346108-81346130 CTCGGGTGCCTTCCCTCGTGGGG - Intergenic
1154449493 18:14462652-14462674 TTCCCCTGCCCTCTCTGGTGGGG + Intergenic
1155308075 18:24498598-24498620 TCTGGGTGCCCTCACTGCTGGGG - Intergenic
1157259322 18:46164997-46165019 TTTGGGTGCCCTCCCTTGTATGG + Intergenic
1161103475 19:2432621-2432643 ATGGGGTGACCTAGCTGGTGGGG - Intronic
1163023602 19:14496481-14496503 CTCGGGTGCCCTGGGTGGTGAGG + Intergenic
1163103761 19:15111738-15111760 CTCGGGTGCCCTCAGTGGTGGGG - Exonic
1167894285 19:52568806-52568828 GACAGGTGCCCTCTCTGGTGAGG - Intronic
1167915589 19:52737488-52737510 GACAGGTGCCCTCTCTGGTGAGG + Intergenic
1167994784 19:53393635-53393657 TACAGGTGCCCTCTCTGGTGAGG - Intronic
1167999050 19:53430469-53430491 GACAGGTGCCCTCTCTGGTGAGG - Intergenic
929961229 2:46497793-46497815 TGAGCGTGCCCTGGCTGGTGAGG + Intronic
932374889 2:71226900-71226922 CTCGGGTGCCCGGGCTGCTGGGG - Intronic
932396733 2:71453900-71453922 TGTGGGTCCCCTCGCTGGAGAGG - Intronic
933079888 2:77972660-77972682 TTGGGGTGCCCTGGCTGAGGAGG - Intergenic
933317550 2:80733900-80733922 TTTTGGTGGCCTGGCTGGTGGGG - Intergenic
941337099 2:164259716-164259738 CTCTGTTGCCCTGGCTGGTGTGG - Intergenic
946125680 2:217560564-217560586 TAAGGGTGCCCTGGCTGATGAGG - Intronic
946495518 2:220192134-220192156 TCCTGGTGCCCTCTCTGGAGAGG + Intergenic
946495726 2:220193380-220193402 TCCTGGTGCCCTCTCTGGAGAGG - Intergenic
948459616 2:238122799-238122821 TTGGGGTGGCCTTGCTGTTGAGG + Intronic
1171426277 20:25050703-25050725 TCCTGGTGCCCTGGCTGCTGTGG - Intronic
1171529665 20:25844710-25844732 TTCGGGTCCCCTCTCTGCTGGGG - Intronic
1171547161 20:26011178-26011200 TTCGGGTCCCCTCTCTGCTGGGG + Intergenic
1175261134 20:57674819-57674841 TTTGCGTGCCCTCGCTCCTGAGG - Intronic
1175678159 20:60965051-60965073 TTGGGCTGCCCTTGCTGCTGGGG - Intergenic
1175762956 20:61573571-61573593 CTGGGGTGCCCACGCTGGTCAGG - Intronic
1176254725 20:64145976-64145998 TTTGGGTCTCCTGGCTGGTGGGG + Intergenic
1178843747 21:36157343-36157365 TGCTGGTGCCCTGGCTGGGGAGG + Intronic
1179936936 21:44612030-44612052 TTTGTGTGCCCTGGCTGCTGAGG - Intronic
1180108370 21:45634509-45634531 TTCTGGTCCCCGTGCTGGTGGGG + Intergenic
1183605649 22:38865684-38865706 TTCTGATGCCCTGGCTGATGTGG + Exonic
1184778900 22:46636401-46636423 TTCAGCTGCTCTCGCTGCTGGGG - Intronic
950291231 3:11786091-11786113 CTCTGGTGCCCAGGCTGGTGTGG + Intergenic
950657992 3:14449173-14449195 GTCGGTTGCCCTCACTGGTGTGG + Intronic
953830954 3:46297293-46297315 TTAGGGTGGCCTCTCTGGTGTGG - Intergenic
961569508 3:127787666-127787688 TGAGGGTGTCCTCGCTGGAGGGG + Intronic
969673885 4:8604252-8604274 TTCGGGTGCACAAGTTGGTGGGG + Intronic
975367486 4:73545554-73545576 GTTTGGTGCCCTTGCTGGTGAGG - Intergenic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
982460881 4:155667563-155667585 ATCGGGTTCCCACGCTGGGGAGG + Intronic
994642087 5:102422235-102422257 TTTGTGTTCCCTTGCTGGTGAGG - Intronic
995538569 5:113162051-113162073 TTCGTGTTCCCTCTCTGATGGGG + Intronic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1003596803 6:7481390-7481412 ATCGGTTCCCCTCGCTGGAGCGG - Intergenic
1003995536 6:11537296-11537318 TTCGGGGGCCCGCGCTGCAGGGG - Intergenic
1006904301 6:37522721-37522743 TTGGGGTGGCCTTGCTGGAGAGG + Intergenic
1012534968 6:100284298-100284320 TTTTGGTGCCATTGCTGGTGAGG - Intergenic
1014352543 6:120362815-120362837 TTTTGGTTCCCTTGCTGGTGAGG + Intergenic
1021641411 7:22741148-22741170 TTCGGTTGCCTGTGCTGGTGGGG - Intergenic
1022677463 7:32513249-32513271 TTAGGGTGCCCTGGCTGAGGAGG - Intronic
1024078210 7:45834341-45834363 ATCTGGTGCCCTCCATGGTGGGG - Intergenic
1036663838 8:10726180-10726202 TACGGGTGCCCTGGCAGGTGGGG + Exonic
1048299188 8:133238979-133239001 TGCGGGTGCCCTCGCTGGTGTGG + Exonic
1048299196 8:133239009-133239031 TTCGGGTGCCCTCGCTGGTGTGG + Exonic
1049385639 8:142341658-142341680 CGGGGGTGACCTCGCTGGTGTGG - Intronic
1049597775 8:143492614-143492636 GTCAGGTGCCCACGCAGGTGTGG - Intronic
1053797642 9:41740995-41741017 TTCGGGTCCCCTCTCCGCTGGGG - Intergenic
1054467293 9:65505000-65505022 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1054652448 9:67635475-67635497 TTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1061368803 9:130186571-130186593 TTCGGGAGCCCTGGAAGGTGAGG - Intronic
1191069497 X:56384726-56384748 TTTGGGTGCCCTGGCTGAGGAGG + Intergenic
1193330589 X:80231997-80232019 TTCGGGTGTGCTCTTTGGTGTGG + Intergenic
1194110743 X:89831004-89831026 TTTGGTTGCCCACGCTTGTGGGG - Intergenic
1197839580 X:130731021-130731043 TTAGGGTGCCCTGGCTGAGGAGG + Intronic
1200463402 Y:3485742-3485764 TTTGGTTGCCCACGCTTGTGGGG - Intergenic