ID: 1048300055

View in Genome Browser
Species Human (GRCh38)
Location 8:133244920-133244942
Sequence CACAGTCTCACAGCCTGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 360}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048300055_1048300062 13 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300062 8:133244956-133244978 AATGGGCAGCGCTGACGGCAAGG No data
1048300055_1048300063 14 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300063 8:133244957-133244979 ATGGGCAGCGCTGACGGCAAGGG No data
1048300055_1048300068 26 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300068 8:133244969-133244991 GACGGCAAGGGAGCAGGGGGAGG No data
1048300055_1048300067 23 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300067 8:133244966-133244988 GCTGACGGCAAGGGAGCAGGGGG No data
1048300055_1048300058 -4 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300058 8:133244939-133244961 TGTGCAGCCAGCCTGGAAATGGG No data
1048300055_1048300061 8 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300061 8:133244951-133244973 CTGGAAATGGGCAGCGCTGACGG No data
1048300055_1048300057 -5 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300057 8:133244938-133244960 CTGTGCAGCCAGCCTGGAAATGG No data
1048300055_1048300065 21 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300065 8:133244964-133244986 GCGCTGACGGCAAGGGAGCAGGG No data
1048300055_1048300066 22 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data
1048300055_1048300064 20 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300064 8:133244963-133244985 AGCGCTGACGGCAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048300055 Original CRISPR CACAGTCTCACAGCCTGCAA TGG (reversed) Intronic
900740388 1:4327423-4327445 CACAGTTCCACAGGCTGCACAGG - Intergenic
900810456 1:4797841-4797863 CACAGTGTCCAAGCCAGCAAGGG - Intergenic
902121342 1:14168593-14168615 CACAGTCCTATAGCCTGTAATGG - Intergenic
902758807 1:18567330-18567352 CACAGTCACCCAGCCAGAAACGG + Intergenic
903016426 1:20365077-20365099 CACAACCTCACAGCAAGCAAGGG - Intergenic
903385930 1:22926406-22926428 CACAGTTACACAGCTAGCAAGGG + Intergenic
903774486 1:25783835-25783857 AACAGTCTCAAATCCTGAAAAGG - Exonic
904728265 1:32567092-32567114 CACAGTTCCACAGGCTGTAAAGG + Intronic
904929322 1:34073855-34073877 CACAGTCCCACTGGCTGCACAGG + Intronic
905387020 1:37612097-37612119 CAAACCCTCACACCCTGCAAAGG + Exonic
905537927 1:38738124-38738146 CACAGGTGCACAGCCTACAAAGG + Intergenic
906573077 1:46861750-46861772 GTCAGTCTCAGGGCCTGCAAAGG - Intergenic
907427838 1:54392057-54392079 CACAGTCCCACCCCCTCCAATGG + Intronic
911356407 1:96826508-96826530 CAGAGCCTCACAGCCAGCACAGG - Intergenic
912342560 1:108931404-108931426 CACTGGATCACAGACTGCAAAGG + Exonic
913117937 1:115713769-115713791 CACATGCTCAGAGCCTGCACTGG + Intronic
914334003 1:146698868-146698890 CACAAACTCACAGGCTTCAAAGG - Intergenic
915349499 1:155215531-155215553 CCCAGTCTCCCTTCCTGCAAAGG - Intergenic
916951508 1:169785133-169785155 CACTGTCACACATCCTGCGAGGG - Intronic
918430478 1:184454784-184454806 CACAGTTCCACAGGCTGCACAGG - Intronic
919367745 1:196685941-196685963 CACAGTTCCACAGCCTGTACAGG + Intronic
920093845 1:203472979-203473001 CAAGGTCACACAGCATGCAATGG + Intergenic
920768278 1:208854429-208854451 CAAAGTCCCACAGTCTGTAAGGG - Intergenic
921232703 1:213089253-213089275 CACATGCTAACAGCCTACAACGG - Intronic
923119483 1:230977908-230977930 CACAGGCTCAAGGCCTGCAGGGG + Intronic
923188971 1:231601845-231601867 CAAAGTCTCACAGTGTGCAGAGG - Intronic
923420844 1:233813445-233813467 CACAGTTCCACAGGCTGCACAGG + Intergenic
924266000 1:242282931-242282953 CTCCGTATCACAGCCTGCTAAGG - Intronic
1063198440 10:3764685-3764707 CCCAGTCTCACACCCTGTATGGG - Intergenic
1063887914 10:10598466-10598488 AGAAGTCTCACATCCTGCAACGG + Intergenic
1065041070 10:21696963-21696985 TAGAGTCTCACAGGCTACAAAGG - Intronic
1065337560 10:24669709-24669731 GACAGTAACACAGCCTGAAAAGG - Intronic
1066718837 10:38315606-38315628 CTCTGTATCACAGCCTGCTAAGG + Intergenic
1067818235 10:49500506-49500528 CACAGACTGACAGTCTGCAGAGG + Intronic
1068004352 10:51374855-51374877 CTCAGTCTGACAACCAGCAAAGG - Intronic
1068063263 10:52096332-52096354 CACTGGCTCACAGCCTGACATGG + Intronic
1070001169 10:72378532-72378554 CACAGTTCCACAGGCTGTAAAGG - Intronic
1070324291 10:75377865-75377887 CACAGTTTTACAGGCTGCACAGG + Intergenic
1070701105 10:78602326-78602348 AGCAGTCTCACAGCCCGCACTGG - Intergenic
1071069394 10:81673849-81673871 CACAGTTTCACAGGCTGTACAGG + Intergenic
1071446608 10:85754781-85754803 CAAGGTCACACAGTCTGCAAGGG - Intronic
1071863263 10:89698106-89698128 CATTGTCTCACAGCCTTCCATGG + Intergenic
1071983192 10:91024248-91024270 TGCAGCCTCACAGCCAGCAAGGG - Intergenic
1072392319 10:94999929-94999951 CCCTGTCACACATCCTGCAAGGG - Intergenic
1072995191 10:100237340-100237362 AATAGTCTCAAAGCCTGCATGGG - Intronic
1073984516 10:109193280-109193302 CCCTGTCACACATCCTGCAAGGG - Intergenic
1074250007 10:111735613-111735635 CAGAGTCTCAAAGGCTGCACAGG + Intergenic
1075003609 10:118815285-118815307 CAGAGTTTCATGGCCTGCAAAGG - Intergenic
1075303742 10:121349004-121349026 CACTGTTTCACAGCCTGAAATGG - Intergenic
1075470689 10:122687257-122687279 CACAGTTTCACAGGCTGTACAGG + Intergenic
1076022817 10:127088735-127088757 CAGAGTCACCCAGCCTGAAAGGG + Intronic
1077630457 11:3808066-3808088 CCGGGTCTCACTGCCTGCAAAGG + Intronic
1078611175 11:12820731-12820753 CACAACCCCACAGCCTGCACAGG - Intronic
1078697005 11:13644480-13644502 CACAGTTTCACAGGCTGTACAGG + Intergenic
1079465472 11:20725436-20725458 CACAGACTTACAGCCTGCCTTGG - Intronic
1080421806 11:32117477-32117499 CACAGTCACACAGCCAGAAAGGG + Intergenic
1081800452 11:45855307-45855329 CACAGCCTCACAGCCTGCAATGG - Intronic
1083224347 11:61275225-61275247 CAAATTCTCACAGCCTCCAGGGG - Intronic
1083579273 11:63814159-63814181 CGCCGTCTCACAGCCTGGGAAGG + Intronic
1083855982 11:65393342-65393364 CACAGTCACACAGCAAGCGACGG - Intronic
1084715064 11:70868534-70868556 CAAAGTCACACAGCCTGTGAAGG + Intronic
1085044412 11:73344768-73344790 CACAGTCACACAGCCAGTAAGGG + Intronic
1085961488 11:81467540-81467562 CACAGTCCCACAGGCTGTACAGG - Intergenic
1086335431 11:85796174-85796196 CAGAGTCTCACAGCTTTTAAGGG - Intronic
1086538436 11:87878617-87878639 CACAGCCTCACTGTCAGCAATGG - Intergenic
1086924953 11:92630219-92630241 CACAGTGTCACAGGCATCAAGGG - Intronic
1087039559 11:93785092-93785114 CAAGGTCACACAGCCGGCAAGGG - Intronic
1087694206 11:101356941-101356963 CACAGTTCCACAGGCTGTAAAGG - Intergenic
1088412764 11:109553677-109553699 CACAGTTTCACAGGCTGTATTGG + Intergenic
1089209432 11:116790428-116790450 CTCAGTCCCAGTGCCTGCAAAGG + Exonic
1089637410 11:119824249-119824271 CTCAGTATCAGAGACTGCAAGGG - Intergenic
1089764411 11:120752414-120752436 CAGAGTCACACAGCCCGCCAAGG + Intronic
1089933773 11:122342447-122342469 CACAGTTTCACAGGCTGTACAGG + Intergenic
1090518615 11:127455160-127455182 CTCAGCCTCACAGACTGCACGGG - Intergenic
1090540668 11:127699981-127700003 CCCTGTTTCACATCCTGCAAGGG - Intergenic
1090596659 11:128328006-128328028 CAAATTCTCACAGCCTGCTGAGG - Intergenic
1090842654 11:130506373-130506395 CACAGTTTCACAGGCTGTACAGG - Intergenic
1092570040 12:9711213-9711235 CCCCATCTCACACCCTGCAAGGG + Intergenic
1096998574 12:55856427-55856449 CAGGGTCACACACCCTGCAAAGG + Intergenic
1097461742 12:59871557-59871579 CACAGGCTCAAGGCCTGCCAAGG + Intergenic
1098930424 12:76405959-76405981 CAAAGTCACAGAGCCTGTAAGGG - Intronic
1099830274 12:87833229-87833251 CACAGTTTCACAGGCTGTACAGG - Intergenic
1100339965 12:93669591-93669613 CACAGTTGCACAGGCTGCTAAGG + Intergenic
1100785175 12:98071109-98071131 CACAGTTCCACAGGCTGCACAGG + Intergenic
1102009387 12:109608701-109608723 CTCAGTCTCACAGCCTGCTAGGG + Intergenic
1102454762 12:113064606-113064628 CATGGTCACACAGCCAGCAAGGG - Intronic
1102892685 12:116572836-116572858 CAGAGTCTCAGAGGCTGCTAGGG + Intergenic
1103242115 12:119422415-119422437 CACAGTTTCGCAGGCTGCACAGG + Intronic
1109342099 13:61075341-61075363 CACAGTTCCACAGGCTGCACAGG - Intergenic
1110126005 13:71942866-71942888 CACAGTTTCACAGGCTGTACAGG - Intergenic
1110142761 13:72151043-72151065 CACCATCTCACAGCATGCAATGG + Intergenic
1110909214 13:80934236-80934258 CACAGTTCCACAGGCTGTAAAGG + Intergenic
1111099087 13:83557392-83557414 CTCAGTCTGAGAGCATGCAAAGG + Intergenic
1111693322 13:91592563-91592585 CACAGTCTCAGAGCATGAAGGGG - Intronic
1113606352 13:111610348-111610370 CACAGTTCCACAGCCTGTACAGG - Intronic
1113814145 13:113159883-113159905 CACAGGCTCTCAGCCTGCGAGGG - Intronic
1115801669 14:37000899-37000921 CACAGTTTCACAGACTGAACAGG - Intronic
1116120022 14:40711001-40711023 CACAGTTTCACAGACTGCACAGG - Intergenic
1118274363 14:64372608-64372630 CACAGTTCCACAGGCTGCATGGG + Intergenic
1118487250 14:66225442-66225464 CCCTGTCACACACCCTGCAAGGG + Intergenic
1120200092 14:81528423-81528445 CACATTCACACAGCCTGCTTTGG + Intronic
1120317862 14:82919345-82919367 CACAGTTTCACAGGCTGTACAGG + Intergenic
1120691522 14:87598546-87598568 CACAGTTCCACAGCCTGCACAGG + Intergenic
1120949166 14:90025151-90025173 CACAGTGTCACACACTGCAGAGG + Intronic
1121032251 14:90668367-90668389 CAAAGTCTCACAGCTAGGAAAGG + Intronic
1121148004 14:91603606-91603628 CACAGTTCCACAGGCTGCACAGG + Intronic
1121323916 14:93008721-93008743 CACGGGCACACAGCCTGCACAGG + Intronic
1121866246 14:97365330-97365352 CACACACTCACAGCCTGCACAGG - Intergenic
1125105297 15:35963911-35963933 CACAGCCTAATTGCCTGCAAAGG + Intergenic
1126802374 15:52310650-52310672 CACAGTCAAACAGCAGGCAACGG + Exonic
1128085295 15:64882297-64882319 CACAGCCTCACAGGCAGAAAGGG + Intronic
1128519993 15:68368973-68368995 CACAGTCACACAGCTTGCCAGGG - Intronic
1128732770 15:70032581-70032603 CCCAGGACCACAGCCTGCAAAGG + Intergenic
1129657981 15:77537285-77537307 CAAGATCTTACAGCCTGCAATGG - Intergenic
1129885705 15:79035694-79035716 CATGGTCTCACAGCCGGGAAGGG - Intronic
1131365621 15:91837034-91837056 CCCTGTCACACATCCTGCAATGG - Intergenic
1131945656 15:97617568-97617590 TAAAGTCTCCCAGCATGCAATGG - Intergenic
1132653326 16:1031243-1031265 CACTGTCTCCCACCCTGCAGTGG - Intergenic
1132836187 16:1954516-1954538 GACAGTCTCCCAGCCTGTGAGGG - Intronic
1135619645 16:23944901-23944923 CATTGTTTCTCAGCCTGCAAAGG - Intronic
1135851586 16:25968644-25968666 CAATGTCACACAGCCTGTAAGGG - Intronic
1136476442 16:30516733-30516755 CACTCTCACACACCCTGCAAGGG - Intronic
1137810821 16:51350937-51350959 CACAGTTCCACAGGCTGTAAAGG + Intergenic
1137840665 16:51637873-51637895 GACAGTCCCCCAGCCTGCAGTGG - Intergenic
1138701255 16:58866016-58866038 CACAGTCTGAAAGCCTGCTCTGG + Intergenic
1139345954 16:66304021-66304043 CAAAGTCACACAGCTTGCAAGGG + Intergenic
1139579854 16:67866149-67866171 CACAGTCTCAGAGCCTGATTGGG + Intronic
1139999615 16:71012381-71012403 CACAAACTCACAGGCTTCAAAGG + Intronic
1141532341 16:84655173-84655195 CACATTCTCACAGCCTGTGGAGG - Intronic
1142258211 16:89025915-89025937 CGCACTCTCTCAGCCAGCAAAGG + Intergenic
1144430903 17:15191083-15191105 CTCTGTCTCACACCCTGCGAGGG - Intergenic
1145318893 17:21751299-21751321 CATCATCTCACAGCCTTCAAAGG - Intergenic
1145815459 17:27792188-27792210 CACAGTCTAACATCCAGCCATGG - Intronic
1149201160 17:54187665-54187687 CACAGTTCCACAGGCTGCACAGG + Intergenic
1149510094 17:57233858-57233880 CACAGTTCCACAGGCTGCACAGG + Intergenic
1151005401 17:70430223-70430245 CAAAGTCACACAGCCAGTAATGG - Intergenic
1151203037 17:72482978-72483000 CACAGTTTCACAGGCTGTACAGG + Intergenic
1151350546 17:73529299-73529321 CAAAGTCTCCCAGCCTCCAGTGG - Intronic
1152540647 17:80972717-80972739 CCCATCCTCACAGCCTGTAAAGG + Intergenic
1154472491 18:14718420-14718442 CAAAGTCTCACAGCTAGGAACGG - Intergenic
1155021534 18:21901257-21901279 CACAGTTCCACAGGCTGCACAGG - Intergenic
1155364994 18:25040963-25040985 CAGATTCTCACAGCCTGCAAAGG - Intergenic
1156632490 18:38986379-38986401 CACAGTCCCACAGGCTGTACAGG - Intergenic
1156710254 18:39935731-39935753 CACAGTTTCACAGGCTGTACAGG + Intergenic
1157160741 18:45312084-45312106 CATAGTCACACAGCTTGTAAGGG - Intronic
1157279725 18:46338400-46338422 AACTGGCTCACAGCCTGCAGAGG - Intronic
1157523926 18:48364279-48364301 CACAGACGCACAGCGAGCAAAGG + Intronic
1158433987 18:57420399-57420421 CACAGTTCCACAGGCTGCACAGG - Intergenic
1158735518 18:60075088-60075110 GTTAGTCTCAGAGCCTGCAAGGG - Intergenic
1158739800 18:60127423-60127445 CACGGTTTCACAGCCTGTACAGG + Intergenic
1158846509 18:61448505-61448527 CACAGTCGCACTTCCTGAAAGGG - Intronic
1160000778 18:75019723-75019745 CACAGTTCCACAGGCTGCACAGG + Intronic
1160013891 18:75126201-75126223 CACAGCCACACAGCCTACACAGG - Intergenic
1160080212 18:75719514-75719536 CACAGTTTCACAGTCTGTACAGG + Intergenic
1160116468 18:76084059-76084081 CACAGTGTCACAGGATGCATGGG + Intergenic
1161642316 19:5432042-5432064 CAAAGCCTCCCAGCCTCCAAAGG - Intergenic
1161815478 19:6497175-6497197 CTCTGTCTCCCAGGCTGCAATGG - Intronic
1163353704 19:16795883-16795905 CACAGTGTCACAGCCTTCCTGGG + Intronic
1165240052 19:34459163-34459185 CACAGTATCACAGCAAGCAGAGG + Intronic
1166054516 19:40280382-40280404 CACTGCCTTACAGCCAGCAAAGG - Intronic
1166851097 19:45761710-45761732 CTGAGTCCCACAGCCTGCACCGG + Exonic
1166959091 19:46487304-46487326 CAAGGTCACACAGCTTGCAAGGG - Intronic
925010675 2:483568-483590 CACAGTTCCACAGGCTGCACAGG + Intergenic
925975238 2:9137747-9137769 CGAAGACACACAGCCTGCAAAGG + Intergenic
925985106 2:9208154-9208176 CACAGTCTCTGATCCTGGAAAGG - Intronic
926301177 2:11604038-11604060 CAAAGTCTCACAGCTAGTAAAGG + Intronic
926609335 2:14930079-14930101 CACAGTTCCACAGGCTGCACAGG - Intergenic
927010632 2:18900056-18900078 CACAGTCTCTGAGGCTGCAAAGG - Intergenic
927432246 2:23036565-23036587 CAGAATCTCACAGCCTGGACCGG - Intergenic
927442971 2:23132581-23132603 CACAGTTCCACAGGCTGCACAGG + Intergenic
928753040 2:34493457-34493479 GACAGTCTCAAAGCCTTTAATGG + Intergenic
929530943 2:42752282-42752304 CACAGCCTCAGAGCATGCCAAGG - Intronic
930521599 2:52474400-52474422 GACAGCCTCACAGCCTGCATGGG + Intergenic
931094189 2:58920802-58920824 CACAGTCTCTGAGCGTGCATAGG + Intergenic
931269600 2:60689734-60689756 CACAGTTTCACAGGCTGTATAGG - Intergenic
931821491 2:65956629-65956651 CACAGTCACTGTGCCTGCAATGG + Intergenic
933948389 2:87308044-87308066 CACAATGCCACAGCCAGCAAAGG - Intergenic
934656618 2:96119763-96119785 TAAGGTCTCACAGCCAGCAATGG - Intergenic
935030178 2:99314174-99314196 CACAGTTTTAAAGGCTGCAAAGG - Intronic
936331810 2:111553551-111553573 CACAATGCCACAGCCAGCAAAGG + Intergenic
937316051 2:120932791-120932813 CCCAGTCTCCCAGCCTGCCGTGG - Intronic
937465231 2:122126459-122126481 CACAGTCCCACAGTCTGTACAGG - Intergenic
937593218 2:123640303-123640325 CACAGTCTTACAGCCTTGCAGGG - Intergenic
937696848 2:124817978-124818000 CACATTCTCACACACTGCAGCGG + Intronic
937916588 2:127102244-127102266 GACAGTCACACAGCTTGTAAGGG + Intronic
939436269 2:142181420-142181442 CACAATCGCACGCCCTGCAAGGG + Intergenic
939442840 2:142272090-142272112 CACAGTATCACAGCTTTCAATGG + Intergenic
939798972 2:146683454-146683476 CACAGTCCCACAGTCTGTACAGG + Intergenic
940149137 2:150579674-150579696 CACAGTTGCACAGCCTGTATAGG + Intergenic
940301590 2:152181031-152181053 CAGGGTCTCACAGCCTTCAGAGG + Intergenic
940422645 2:153498360-153498382 CACAGCCTGCCAGCCTTCAAGGG - Intergenic
940636959 2:156309310-156309332 CACAGTTTCACAGACTGTACAGG + Intergenic
941845223 2:170125820-170125842 CACAGTCTCACAGCTTCCTTTGG - Intergenic
942549256 2:177097450-177097472 TTCAGTCTCATAGCCAGCAAAGG - Intergenic
942736480 2:179119886-179119908 CACAGTCCCACAGGCTGTACAGG - Intronic
942986674 2:182151478-182151500 CAAAGTCTTAAAGCCAGCAAGGG + Intronic
943533357 2:189115664-189115686 CACAGTCTCACAGCTCACAGGGG - Intronic
943647215 2:190419051-190419073 AACAGTCACACAGGCTACAAGGG - Intronic
943762821 2:191628502-191628524 CACAGTCCCCCAGCATGCATAGG - Intergenic
943838823 2:192551892-192551914 CCCTGTCGCACACCCTGCAAGGG - Intergenic
943945946 2:194064700-194064722 CACAGTTTCACAGGCTGTACAGG + Intergenic
944479611 2:200143517-200143539 CACAGTTTCACAGGCTGTAAAGG + Intergenic
945683851 2:212945712-212945734 AACAGTATCTGAGCCTGCAAGGG + Intergenic
945917350 2:215717927-215717949 AACTTTCTCACAGCCTGGAAGGG - Intergenic
946565195 2:220956731-220956753 CAGGGTTTCACAGCTTGCAACGG - Intergenic
946911343 2:224464398-224464420 CACAGTTCCACAGCCTGTATAGG + Intergenic
948313074 2:237004219-237004241 CACAGTCCCACAGGCTGTACAGG - Intergenic
1168850431 20:972976-972998 CACAGACTCACACCCTGACATGG + Intronic
1170703720 20:18726986-18727008 CACAGACTCTCAGCCAGCCAAGG - Intronic
1171453554 20:25253118-25253140 CACAGTTTCACAGCCTCCCATGG + Intronic
1172011026 20:31845644-31845666 CCCAGCCTCCCAGCCTGGAAAGG + Intergenic
1173326846 20:42041638-42041660 CAAGGTTGCACAGCCTGCAATGG - Intergenic
1173539847 20:43843117-43843139 CAGAGTCTCACAGTCAGTAATGG + Intergenic
1173638942 20:44585534-44585556 CAGAGTCTCACAGCTGGCAGGGG + Intronic
1174085728 20:48006074-48006096 CACAGTCACACAGCTTGGAAGGG + Intergenic
1174125538 20:48302137-48302159 CAGGATCTCACAGCCTGGAAGGG - Intergenic
1174274568 20:49394404-49394426 CAAACTCTCCCAGCCTGCACTGG + Intronic
1174964852 20:55200530-55200552 CACAGTTTCACAGGCTGTACAGG - Intergenic
1175486593 20:59351315-59351337 CACACTATCACACCCTGAAAGGG - Intergenic
1175948148 20:62568257-62568279 CACAGTCACACAGCCAGCCCTGG + Intronic
1176801999 21:13439473-13439495 CAAAGTCTCACAGCTAGGAACGG + Intergenic
1176886790 21:14265912-14265934 CACAGTTCCACAGCCTGTACAGG - Intergenic
1177172467 21:17669593-17669615 CACTGTTTCCCAGGCTGCAATGG + Intergenic
1177188486 21:17823893-17823915 CACAGTTCCACAGGCTGCACAGG + Intergenic
1177614637 21:23500896-23500918 CACAGTTCCACAGGCTGCACAGG - Intergenic
1177718693 21:24875936-24875958 CACTATCTCACAGTCTGGAAAGG + Intergenic
1178261999 21:31108108-31108130 CACAGTTTCACAGGCTGTACAGG - Intergenic
1178291347 21:31371304-31371326 CACAGACTCCCAGAATGCAAAGG + Intronic
1179172107 21:38980858-38980880 CACATACACTCAGCCTGCAACGG + Intergenic
1179975436 21:44863055-44863077 CACAGACACACAGCCCGCCACGG + Intronic
1180232786 21:46437317-46437339 CACAGTCACACAGCATCCCATGG - Intronic
1181053717 22:20249538-20249560 CACAGACTCAGTGCATGCAATGG + Intronic
1181539189 22:23564267-23564289 CAAGGTCTCACAGCTTGGAAGGG + Intergenic
1182115223 22:27752715-27752737 CAAGGTCACACAGCCTGGAAGGG + Intronic
1182246909 22:28965484-28965506 CCCAGGCTCACAGCCTGCCTGGG - Intronic
1182984195 22:34701040-34701062 CACAGTCTCACTGCCAGCAATGG - Intergenic
1183327761 22:37203701-37203723 CACAATATCACACCCAGCAAAGG + Intergenic
1183336613 22:37251451-37251473 CACAGTATCACAGGCCGCACAGG + Intergenic
1183735482 22:39642572-39642594 CACTGTCACACAGCCAGGAAGGG - Intronic
1183750213 22:39715828-39715850 CACGGTCTCACAGCAGGCAGGGG + Intergenic
1185005260 22:48272306-48272328 CACTTTGTCAGAGCCTGCAAGGG - Intergenic
950151498 3:10691150-10691172 AGAAGTCACACAGCCTGCAAGGG - Intronic
953835289 3:46338156-46338178 CACAGTTCCACAGGCTGCACAGG + Intergenic
957758468 3:84523131-84523153 CACGGTCACACACCCTGCAAGGG + Intergenic
958927874 3:100178920-100178942 CACAGTTTCACAGGCTGTACAGG + Intergenic
959149605 3:102592280-102592302 CACAGTTCCACAGGCTGCACAGG - Intergenic
959647962 3:108724388-108724410 CACAGTCCCACAGGCTGTACAGG - Intergenic
959830639 3:110857698-110857720 CAGACTCTACCAGCCTGCAATGG + Intergenic
960053807 3:113262175-113262197 TCCAGTCTCCCTGCCTGCAAAGG + Intronic
961676788 3:128572455-128572477 CACAGTCACACAGCAGGCAGTGG - Exonic
963043209 3:141083987-141084009 CAGAGTCCCACAGCCTGCAGTGG - Intronic
963078452 3:141369113-141369135 AACATTCTGACAGCCTGAAACGG - Intronic
964073252 3:152661588-152661610 CACAGTTTCACAGGCTGTACAGG - Intergenic
965619214 3:170625648-170625670 CACAGTTCCACAGCCTGTACAGG - Intronic
967069881 3:185953276-185953298 CCCTGTCGCACATCCTGCAAGGG + Intergenic
969150299 4:5163667-5163689 CAAAGACTTAAAGCCTGCAAGGG - Intronic
970463972 4:16304732-16304754 CACAGTATCAAAGCCTGCAGTGG - Intergenic
970683701 4:18540622-18540644 CACAGTTCCACAGGCTGCACAGG - Intergenic
970875969 4:20870417-20870439 CACAGTTGCACAGGCTGTAAAGG - Intronic
971224508 4:24738413-24738435 CACAGTCCCACAGGCTGTACAGG - Intergenic
972561886 4:40236171-40236193 CACAGTCACACAGCAAGGAATGG - Intronic
974323989 4:60390344-60390366 CACAGTTCCACAGGCTGTAAAGG + Intergenic
975067202 4:70081521-70081543 CACAGGCTCATAGACTACAAGGG - Intergenic
975087951 4:70366188-70366210 CAGAGTCTCACAGGCTGAAAAGG + Intronic
977519357 4:98061285-98061307 CACAGTTTCACAGGCTGTACAGG + Intronic
978375571 4:108072094-108072116 AAGAATCTCATAGCCTGCAATGG - Intronic
979098135 4:116576548-116576570 CAAATTCTCACAGGCTTCAAGGG - Intergenic
980458736 4:133077366-133077388 CACAGTCCCACAGTCTGTACAGG + Intergenic
980574654 4:134669311-134669333 CACACACACACATCCTGCAATGG - Intergenic
980604232 4:135068145-135068167 CAGAGGTTCAGAGCCTGCAAGGG - Intergenic
980617014 4:135241989-135242011 CACAGACACACACACTGCAAAGG + Intergenic
981193492 4:141891271-141891293 CACAGTTTCACAGGCTGTACAGG + Intergenic
981806325 4:148719637-148719659 CACAGGCTCATGCCCTGCAAGGG + Intergenic
982505908 4:156217902-156217924 CACAGTTCCACAGGCTGTAAAGG - Intergenic
984480818 4:180298982-180299004 CACAGTTTCACAGCCTGTACAGG - Intergenic
985341052 4:188955198-188955220 CACAGTTTCACAGACTGTACAGG + Intergenic
985400627 4:189589979-189590001 CACACACTCAAAGTCTGCAAAGG - Intergenic
986230895 5:5864185-5864207 CCCTGTCACACATCCTGCAAGGG - Intergenic
986594178 5:9403449-9403471 CAAAGTCACCCAGCCAGCAAGGG - Intronic
987800743 5:22693344-22693366 CACACTCTCACAAGCTGCCAAGG - Intronic
988130451 5:27097164-27097186 CAGAATCTCACAGCCTGCAGTGG + Intronic
989366228 5:40658810-40658832 CACAGTTCCACAGGCTGCACAGG - Intergenic
989629479 5:43466318-43466340 CACTGTCTCCTAGCCTGAAAAGG - Intronic
990766043 5:59183821-59183843 CAGAGTCTATCAGTCTGCAAAGG - Intronic
992448668 5:76856155-76856177 CACAGTTTCACAGGCTGTACAGG - Intronic
994380904 5:99069852-99069874 CACAGTTTCACAGGCTGTACAGG - Intergenic
994479895 5:100321269-100321291 GACAGTCCCACAGCCTGGCAGGG + Intergenic
994677806 5:102847014-102847036 CACACTCTCCCAGCCTTGAAAGG - Intronic
994884933 5:105548723-105548745 CCCAATCTCACACCCTGCGAGGG - Intergenic
994929774 5:106166558-106166580 CACAGTTTCACAGGCTGTACAGG - Intergenic
996027119 5:118658571-118658593 CACAGTTTCACAGACTGTACAGG + Intergenic
997239009 5:132293756-132293778 AACAGGCCCACAGCCTGGAAGGG - Intronic
997965012 5:138349879-138349901 CACAGTATAACATCCTGCCATGG - Intergenic
998505655 5:142669951-142669973 TACAGGATCACAGCCTTCAAGGG + Intronic
999132849 5:149297810-149297832 TAGAGCCTCACAGCCTGCCAAGG + Intronic
999304141 5:150508939-150508961 CAGAGACTCACAGGCGGCAATGG + Intronic
999486281 5:151999655-151999677 GACATTCTCCCAGACTGCAAAGG - Intergenic
1000338826 5:160261436-160261458 CCCAGTCACTCAGCCTGCAATGG + Intronic
1000755024 5:165147557-165147579 CACAGTTTCACAGGCTGTACAGG - Intergenic
1001945694 5:175775748-175775770 CAAAGTCACACAGCCAGGAAGGG + Intergenic
1002603149 5:180366392-180366414 CACAGTCTCAGTGCCTGCTCCGG - Intergenic
1003397291 6:5764222-5764244 CAGAGTCGCACAGCTAGCAAAGG + Intronic
1003630022 6:7778438-7778460 CGAAGTCACACAGCCAGCAATGG + Intronic
1003638379 6:7855495-7855517 CATGGTCACACAGCCAGCAAGGG - Intronic
1004041949 6:11988236-11988258 CACAGTACCACAGTCAGCAATGG + Intergenic
1004350391 6:14885742-14885764 CACCAGGTCACAGCCTGCAATGG - Intergenic
1005931852 6:30490237-30490259 CAGGGTCTCACACCCTGCAGTGG + Exonic
1005932294 6:30492562-30492584 CTGAGTCTCACAGCTTGTAAAGG + Exonic
1006921178 6:37628224-37628246 CACAGTCGCACACACTGCATGGG + Intergenic
1007239135 6:40412548-40412570 CCCAGTCTCATAGCCTGTTAGGG - Intronic
1009543827 6:65000227-65000249 CCCTGTCACACACCCTGCAAGGG + Intronic
1009615270 6:65997141-65997163 CAGAGTCTCACAGCTTGGATTGG - Intergenic
1011370962 6:86635684-86635706 CACAGTCCCTCAGGCTGCACAGG - Intergenic
1014147141 6:118011277-118011299 CACAGTTTCACAGGCTGTACAGG + Intronic
1014755052 6:125293463-125293485 CACAGACTCACAGGCTGAAAAGG + Intronic
1015398538 6:132762342-132762364 GACATTCTCACAGGCAGCAAGGG + Intronic
1015615190 6:135067160-135067182 CACAGTTTCACAGACTGTACAGG - Intronic
1016801427 6:148173192-148173214 CAGAGGCTCACAGCCTCCGAAGG - Intergenic
1017096876 6:150812470-150812492 CACAGTCTCAAAGGCTGCCGAGG + Intronic
1017858874 6:158376666-158376688 CACAGCCTCAGAGGCTGGAAGGG + Intronic
1018418165 6:163619603-163619625 CACAGTTTCACAGGCTGTACAGG + Intergenic
1018572101 6:165222639-165222661 CACAGTCTCTCATCCTCCAGTGG + Intergenic
1020416397 7:7951045-7951067 CACAGTTTCACAGGCTGTACAGG + Intronic
1020974207 7:14984944-14984966 CACAGGCTCAGGGTCTGCAAGGG + Intergenic
1021675895 7:23080647-23080669 CTCACTCTCTCAGCCAGCAAAGG - Intergenic
1023031978 7:36097791-36097813 CACAGTCCCACAGGCTGTATGGG + Intergenic
1023337245 7:39183333-39183355 CACAGTTCCACAGACTACAAAGG + Intronic
1024513022 7:50218064-50218086 CACAGGCTTCCTGCCTGCAAAGG - Intergenic
1025902525 7:65757423-65757445 CACAGTTTGACAGCCTACCAGGG + Intergenic
1026436258 7:70401482-70401504 CACATTTCCACAGCCTCCAAAGG - Intronic
1026546030 7:71322951-71322973 CACAGTATCTCAGCCAGCTAGGG - Intronic
1027788967 7:82615541-82615563 CACAGTTCCACAGCCTGTACAGG + Intergenic
1027874976 7:83757057-83757079 TACAGTATCACAGCCTGGCATGG - Intergenic
1027961046 7:84945726-84945748 TACACTCTCACAGTGTGCAAGGG - Intergenic
1029016984 7:97325463-97325485 CCCTGTCACACATCCTGCAAAGG - Intergenic
1031199916 7:118668920-118668942 CAGAGTCTGACAGCCTGAGAAGG - Intergenic
1031503938 7:122557580-122557602 CACAGGTTTCCAGCCTGCAAAGG + Intronic
1031990667 7:128196921-128196943 CACTGGGTCACAGCCTGCACAGG - Intergenic
1034700519 7:153091715-153091737 CAGAGAGTCAGAGCCTGCAACGG - Intergenic
1034739393 7:153459336-153459358 CAGAGCCTCAGAGCCTCCAAGGG - Intergenic
1034897657 7:154887784-154887806 CACAGTCTCCCAGCCTGCCCTGG + Intronic
1035262233 7:157669335-157669357 CACAGTCCCACCGCCTCCAGTGG + Intronic
1036679833 8:10863939-10863961 CAGAGTCTCACGGTCAGCAAGGG + Intergenic
1038281919 8:26173434-26173456 CACAGTTCCACAGGCTGCACAGG - Intergenic
1039833772 8:41238772-41238794 CACAGTTCCACAGCCTGCAGAGG + Intergenic
1039838716 8:41278481-41278503 TTCAGTCTCCCTGCCTGCAATGG + Intronic
1041644063 8:60233488-60233510 CACAGCCTCACAGCCTGACCTGG - Intronic
1044362495 8:91304496-91304518 CACAGTTCCACAGGCTGCACAGG - Intronic
1044450893 8:92335206-92335228 TGCTGTCTCACAGCCTTCAACGG - Intergenic
1044731361 8:95231132-95231154 CACAGGCTCAGAGCCCTCAATGG - Intergenic
1044841055 8:96337590-96337612 CACAGTCTAACAGTGTTCAAGGG + Intergenic
1044966252 8:97576628-97576650 CAAACTATCACAGCCTACAAGGG - Intergenic
1045663322 8:104460469-104460491 CACAGTTTCACAGGCTGTACAGG - Intronic
1045705872 8:104921713-104921735 CAAAGTTTCACAGCATTCAAGGG - Intronic
1046595369 8:116255149-116255171 CACAGTTCCACAGCCTGTAAAGG - Intergenic
1047937853 8:129799636-129799658 CACAGTTTCACAGACTTCACAGG + Intergenic
1048300055 8:133244920-133244942 CACAGTCTCACAGCCTGCAATGG - Intronic
1048850188 8:138637395-138637417 CAAAGTCTCACAGCTAGTAAGGG - Intronic
1048918607 8:139207432-139207454 CAGTGTCTCACAGCCAGCTATGG + Intergenic
1049086625 8:140483426-140483448 CACAGTTTCACAGGCTGTATAGG - Intergenic
1050109383 9:2199439-2199461 CACAGTTTCACAGGCTGTACAGG + Intergenic
1050741894 9:8830193-8830215 CAAGGTCTCACAGCTTACAAGGG + Intronic
1052572871 9:30250870-30250892 CACAGTTTCACAGGCTGTACAGG - Intergenic
1052668586 9:31526372-31526394 CACAGTTCCACAGCCTGCACAGG + Intergenic
1052778340 9:32755454-32755476 CACAATCGCACACCCTGCGAGGG - Intergenic
1053091865 9:35286025-35286047 CACAGTATCACAGCCCCCAGTGG - Intronic
1055563348 9:77543566-77543588 GAGAGTCTCAAGGCCTGCAAGGG + Intronic
1056266550 9:84902349-84902371 CACATTCTTACAGCATGCATGGG - Intronic
1057015122 9:91644588-91644610 CACAGTCCCCCAGCCTCCACTGG - Intronic
1058085241 9:100741098-100741120 CACAGTTTCACAGGCTGTATAGG - Intergenic
1058428654 9:104898740-104898762 CCCAGTCTCTCTGCCTGGAATGG + Intronic
1058776864 9:108293151-108293173 CAGAGCCTCACAGGCTGGAAGGG - Intergenic
1059617409 9:115966439-115966461 CACAGTTTCACAGGCTGTACAGG + Intergenic
1060172605 9:121474196-121474218 CCCAGTTGCACAGCCTGCAATGG + Intergenic
1060195635 9:121621541-121621563 CACATTCACAAAGCCTGCAAGGG + Intronic
1062653814 9:137591652-137591674 CACCGTGCCCCAGCCTGCAAAGG + Intergenic
1186268498 X:7858744-7858766 CACAGTTCCACAGGCTGTAAAGG + Intergenic
1186656181 X:11614336-11614358 CACAGTTCCACAGCCTGTACAGG + Intronic
1187707793 X:22025047-22025069 CACTGTCTCATACCCTGCGAGGG - Intergenic
1189195945 X:39152440-39152462 CACAGTCACACAACCTTAAATGG - Intergenic
1189723077 X:43940380-43940402 CCAAGTCTCACAGCCAGTAAAGG - Intergenic
1191773984 X:64792838-64792860 CACATTCTCACCTTCTGCAATGG - Intergenic
1193780002 X:85689512-85689534 CACAGCTTCACAGGCTGCACAGG - Intergenic
1193871709 X:86806169-86806191 CACAGTTTCACAGGCTGTACAGG + Intronic
1195164319 X:102203173-102203195 CACAGTTCCACAGCCTGTATGGG - Intergenic
1195194541 X:102483922-102483944 CACAGTTCCACAGCCTGTATGGG + Intergenic
1197339602 X:125250180-125250202 CACAGTTTCACAGGCTGCACAGG + Intergenic
1197440098 X:126477026-126477048 CACAGTTCCACAGGCTGCACAGG + Intergenic
1198032451 X:132766636-132766658 CACAGTTCCACAGACTGCACAGG + Intronic
1198373607 X:136015784-136015806 CAAAGCCACACAGCCAGCAAAGG + Intronic
1199330465 X:146552369-146552391 CACAGTTCCACAGGCTGCACAGG + Intergenic
1199369996 X:147035958-147035980 CAAAGTCTTACAGACTGGAATGG - Intergenic
1200067513 X:153510989-153511011 GACAGGGTCACAGCCTGCAAGGG + Intergenic
1200673296 Y:6120964-6120986 CACAGTCCTGCAGTCTGCAAAGG - Intergenic
1201340289 Y:12925979-12926001 CAGAGTCTGACACCCTGCCAGGG - Intergenic
1201379305 Y:13356107-13356129 CACTGTCTTTCATCCTGCAAAGG - Intronic
1201676540 Y:16591942-16591964 CACAGTTTCACAGGCTACACAGG + Intergenic