ID: 1048300059

View in Genome Browser
Species Human (GRCh38)
Location 8:133244946-133244968
Sequence AGCGCTGCCCATTTCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 156}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048300059_1048300066 -4 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data
1048300059_1048300072 11 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300072 8:133244980-133245002 AGCAGGGGGAGGCTGCGGGGAGG No data
1048300059_1048300069 6 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300069 8:133244975-133244997 AAGGGAGCAGGGGGAGGCTGCGG No data
1048300059_1048300065 -5 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300065 8:133244964-133244986 GCGCTGACGGCAAGGGAGCAGGG No data
1048300059_1048300067 -3 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300067 8:133244966-133244988 GCTGACGGCAAGGGAGCAGGGGG No data
1048300059_1048300068 0 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300068 8:133244969-133244991 GACGGCAAGGGAGCAGGGGGAGG No data
1048300059_1048300073 12 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300073 8:133244981-133245003 GCAGGGGGAGGCTGCGGGGAGGG No data
1048300059_1048300075 20 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300075 8:133244989-133245011 AGGCTGCGGGGAGGGTGGCCTGG No data
1048300059_1048300071 8 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300071 8:133244977-133244999 GGGAGCAGGGGGAGGCTGCGGGG No data
1048300059_1048300064 -6 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300064 8:133244963-133244985 AGCGCTGACGGCAAGGGAGCAGG No data
1048300059_1048300077 22 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300077 8:133244991-133245013 GCTGCGGGGAGGGTGGCCTGGGG No data
1048300059_1048300070 7 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300070 8:133244976-133244998 AGGGAGCAGGGGGAGGCTGCGGG No data
1048300059_1048300078 30 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300078 8:133244999-133245021 GAGGGTGGCCTGGGGTGAAACGG No data
1048300059_1048300076 21 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300076 8:133244990-133245012 GGCTGCGGGGAGGGTGGCCTGGG No data
1048300059_1048300074 15 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300074 8:133244984-133245006 GGGGGAGGCTGCGGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048300059 Original CRISPR AGCGCTGCCCATTTCCAGGC TGG (reversed) Intronic
900106307 1:982576-982598 CACGGTGCCCATTCCCAGGCAGG + Intergenic
900117620 1:1035188-1035210 AGGGGTGCCCCTTTCCAGGCTGG + Intronic
900393374 1:2443425-2443447 AGCGCTTCCCATCTCCAGGCTGG - Intronic
900683433 1:3931638-3931660 AGTCCAGCCCATTTCCAGCCGGG + Intergenic
900715796 1:4142681-4142703 AGCCCTTCCCATTTCCATCCTGG + Intergenic
901065978 1:6494889-6494911 AGCTGTGCCAAGTTCCAGGCAGG + Intronic
902535558 1:17117827-17117849 AGCGGTGCCCAGTTCAGGGCTGG + Intronic
903588742 1:24438276-24438298 AGCTCTGACCTTTTCCAGGTGGG + Intronic
904629501 1:31830425-31830447 AGCGGTGTCCATCTCTAGGCAGG - Intergenic
905007269 1:34719865-34719887 AACTGTGCCCATTGCCAGGCAGG - Intronic
905287449 1:36890865-36890887 AGCGCTTCCCCTCCCCAGGCTGG + Intronic
905975815 1:42172905-42172927 ATCGCTGTCCAGTGCCAGGCAGG + Intergenic
906795560 1:48693861-48693883 AGCCCTGCCCAGTACCCGGCAGG - Intronic
910259722 1:85283723-85283745 AGCCCTGCCCACTTCCAAGTTGG + Intergenic
911449608 1:98046271-98046293 AGCTCAGCCCATCCCCAGGCAGG - Intergenic
911607103 1:99919437-99919459 AGAATTGCCCAATTCCAGGCTGG - Intronic
912691808 1:111810310-111810332 AGAGCTGCCCTCTTCCAGGTAGG - Intronic
918248864 1:182684351-182684373 TGCGCTGCCCACCGCCAGGCAGG - Intronic
919653905 1:200179278-200179300 AGCCCTGCCAATTGCCAGGTTGG - Intergenic
922724815 1:227917913-227917935 TGTGCTTCCCATGTCCAGGCTGG - Intergenic
923247150 1:232143579-232143601 AGCGCTGCCCTTCTGGAGGCTGG + Intergenic
1063291862 10:4757879-4757901 AGCTCTTCCCATATCCAGGAGGG - Intergenic
1063715221 10:8520329-8520351 AGGGATTCCCATTCCCAGGCCGG + Intergenic
1064208985 10:13347838-13347860 GGCGCTGCCCCTCTCCAGGCAGG + Intronic
1069757396 10:70781703-70781725 ATGGCAGCCCATTTCCAGGCTGG - Intronic
1071559317 10:86632807-86632829 AGCCATGCCCAGTTCCAGGAGGG + Intergenic
1072230354 10:93409152-93409174 TGCCCTGCCCTTTCCCAGGCCGG - Intronic
1075075650 10:119348666-119348688 AGCCCTGGCCTCTTCCAGGCTGG - Intronic
1077387495 11:2277212-2277234 AGGACTGGCCAGTTCCAGGCAGG + Intergenic
1077459311 11:2700703-2700725 GGCGCTGCCCTTTGCCAGGTGGG - Intronic
1078400729 11:11024194-11024216 AGCGCTGTCCATATACATGCTGG + Intergenic
1079935700 11:26613904-26613926 GGCACTGGCCATTTCCAGGCTGG + Intronic
1081532940 11:43976627-43976649 AGCTCTGCCATTTTCCATGCTGG + Intergenic
1083276439 11:61599688-61599710 AGAGCTGCCCATCTACAGACGGG + Intergenic
1084733422 11:71089112-71089134 AGAACTGCCCTTTTCCAAGCAGG + Intronic
1086946871 11:92852475-92852497 ATGGCTGAGCATTTCCAGGCTGG + Intronic
1087810864 11:102607950-102607972 AGCTCTATCCATTTCCAGGAGGG - Intronic
1088764368 11:112961972-112961994 AGCGCTGCCCATCACCAGCGCGG - Intronic
1089757124 11:120695299-120695321 AGAGCTGCCCAATGCCAGGATGG - Intronic
1089790091 11:120936684-120936706 AGAGCTGCCCATTTCCCATCTGG + Intronic
1090726223 11:129529692-129529714 ATCACTCCCCTTTTCCAGGCAGG - Intergenic
1090744842 11:129697298-129697320 AGCTCTGCACATTTCCACTCTGG - Intergenic
1096578284 12:52568363-52568385 AGCGATGGCCGTCTCCAGGCTGG + Exonic
1096747665 12:53739083-53739105 AGCTATGCCCACTGCCAGGCGGG + Intergenic
1099295930 12:80827568-80827590 AGCACTTCCCATGTACAGGCAGG + Intronic
1101696921 12:107135395-107135417 AGAGCTTCCCATTTCCTGGTGGG - Intergenic
1101998975 12:109544920-109544942 AGCACTGCCCCTTCACAGGCAGG - Intergenic
1104088252 12:125494361-125494383 GGAGGTGCCCATTTCCAGGGAGG - Intronic
1106581169 13:31019551-31019573 AGGGCAGCCCATTTCAAGGTTGG + Intergenic
1107988666 13:45797933-45797955 AGGGCTGCCCTATTCCAGGGAGG + Intronic
1113028984 13:105973215-105973237 ATCACTGCCCATTTCCACGATGG + Intergenic
1116835968 14:49769038-49769060 ACCGCTGCCCACTTACAGGGAGG + Intronic
1117392313 14:55273280-55273302 AGTTATGCCCATTTTCAGGCAGG + Intronic
1119381942 14:74234710-74234732 AGGGCTACCCAGGTCCAGGCTGG - Intergenic
1120545710 14:85808970-85808992 AAGTCTGCCCATCTCCAGGCTGG + Intergenic
1120991861 14:90383968-90383990 AGCGCTGCGCGCTCCCAGGCGGG - Intergenic
1122077721 14:99246509-99246531 AGCGGTGCCCCTTTCCCGGCTGG - Intronic
1125743941 15:41986488-41986510 ATCCCTGCCCAGTTCCAAGCGGG + Intronic
1125898075 15:43319402-43319424 AACCCTGCCCACTTTCAGGCTGG - Intergenic
1127931455 15:63600097-63600119 AACCCTACCCTTTTCCAGGCTGG + Intronic
1129693880 15:77729579-77729601 AGGGCTGGCCAACTCCAGGCAGG - Intronic
1129909632 15:79215327-79215349 AGGGCAGCCAACTTCCAGGCTGG - Intergenic
1131070600 15:89463314-89463336 AGCCCTTCCCCCTTCCAGGCAGG - Intergenic
1132634740 16:938230-938252 AGCGCTTCCCTGTGCCAGGCAGG - Intronic
1133302561 16:4791656-4791678 AGCCCCGCCCAGTCCCAGGCAGG - Intronic
1133331338 16:4976551-4976573 AGACTTGCCCAATTCCAGGCTGG - Intronic
1136614178 16:31386242-31386264 AGCGCTGCCACCTTCCTGGCTGG - Intergenic
1137626652 16:49913044-49913066 AGCTCCACCCATTTCCAGCCAGG + Intergenic
1138619205 16:58198057-58198079 GCCGCTGCCCCTTTCCCGGCCGG - Intergenic
1140296378 16:73713002-73713024 AGATCAGCCCATTACCAGGCTGG - Intergenic
1141602900 16:85137154-85137176 GGAGCAGCCCATTTCCAAGCCGG + Intergenic
1142039259 16:87882078-87882100 TGGGCTGCCCATTTCCAGGTGGG - Exonic
1144945003 17:18965308-18965330 AGCCTTGCCCATTTCCATGGAGG - Intronic
1147567433 17:41546341-41546363 GGCACTGGCCATGTCCAGGCTGG + Intergenic
1147927000 17:43952532-43952554 GGCGCTGTCCAGCTCCAGGCTGG + Intergenic
1147984017 17:44294044-44294066 AGAGCTGCCCATTGCGAAGCGGG - Intergenic
1148117111 17:45182594-45182616 AGCTCTGCCCATTTCCTGGTCGG - Intergenic
1149908159 17:60545867-60545889 AGCGCTTTCTATTTCCCGGCAGG - Intergenic
1150281582 17:63932249-63932271 AGCGGTGACCATGGCCAGGCTGG - Exonic
1151846261 17:76658113-76658135 AGCACTGCCCATATGCTGGCAGG + Intergenic
1152198696 17:78932840-78932862 AGGCCTGCCCATTTCAGGGCCGG - Intergenic
1156183810 18:34638416-34638438 AGCTCTGCCCTTTTCCAGACAGG - Intronic
1157798693 18:50600564-50600586 AGAGCTGCCCACCTCCAGTCAGG + Intronic
1157981698 18:52389062-52389084 AGCGCTGAGCAGTTCCAGGGAGG - Intronic
1158218782 18:55128707-55128729 AAGGCTGCTCTTTTCCAGGCAGG - Intergenic
1160063884 18:75556826-75556848 AGGGCTGTCCATTGCCAGGCAGG - Intergenic
1160164166 18:76495451-76495473 AGGGCAGACCATTTCCAGGCTGG - Intergenic
1161686379 19:5704646-5704668 AGCCATGCCCATGTCCAGCCAGG - Intronic
1163507844 19:17718934-17718956 AGTGTTGCCCTGTTCCAGGCAGG + Intergenic
1164302211 19:23972299-23972321 AGCCCTGGCCCTTTCCTGGCTGG - Intergenic
1166121005 19:40686880-40686902 AGCCCTGCCCTGTCCCAGGCTGG + Intronic
925033114 2:666642-666664 GGCGCTGCCCAGTCCCAGGATGG - Intergenic
925360433 2:3277104-3277126 AACCCTGCCCATTTAGAGGCAGG + Intronic
925777461 2:7348927-7348949 AGCTATCCCCATTTCCGGGCTGG - Intergenic
926155015 2:10448644-10448666 TGCGCGGACCAGTTCCAGGCGGG - Intergenic
927853691 2:26515047-26515069 AGCGCTGCCCATGTCCAGGCTGG - Intronic
928052013 2:28008887-28008909 AGAGCTGCCCATATCCAGGGGGG - Intronic
928950315 2:36808003-36808025 AGAGCAGCCCTGTTCCAGGCGGG - Intronic
929269571 2:39958961-39958983 ACAACTGCCCAATTCCAGGCAGG - Intergenic
930025140 2:47025128-47025150 AGCTCAGCCCATTTCCTGGGTGG - Intronic
935605441 2:104968507-104968529 AGCACTCCCCATATCCAGCCTGG - Intergenic
936718936 2:115225381-115225403 AGTGCTGCCTATCTCAAGGCAGG - Intronic
937631735 2:124109424-124109446 AGAGCTGTCCCTTGCCAGGCTGG + Intronic
939686404 2:145206000-145206022 AGTGCTGCCCAGTACCATGCTGG - Intergenic
940326342 2:152429293-152429315 AGAGCTGTCCCTTTCTAGGCCGG + Intronic
943569718 2:189559047-189559069 AGCACTCCCCATTGCCATGCTGG - Intergenic
945542407 2:211105207-211105229 GGTGGTGCCCTTTTCCAGGCAGG - Intergenic
948517257 2:238511585-238511607 GGGGCTGCCCAGTTCCAGACAGG - Intergenic
948664146 2:239523999-239524021 AGCGCAGCCTTTTCCCAGGCTGG - Intergenic
1168910745 20:1444731-1444753 ACTGCTGCCCATTCCCAGGGTGG - Intronic
1169131172 20:3167044-3167066 CACGCTGCCCATGGCCAGGCGGG + Exonic
1169206769 20:3745122-3745144 AGCCCTGCCCTTTTCCATGCTGG - Intronic
1169266499 20:4170355-4170377 AGTTCTGGGCATTTCCAGGCGGG + Intronic
1173872373 20:46350177-46350199 AGCTCTGGCCAGTCCCAGGCTGG + Exonic
1174475934 20:50795439-50795461 GGCGCCGCCCTTTGCCAGGCCGG + Intronic
1175724414 20:61307883-61307905 AGCCTGGCACATTTCCAGGCAGG - Intronic
1178802523 21:35809431-35809453 AGAGCTCCCCACTTCTAGGCTGG + Intronic
1179150117 21:38802522-38802544 AACCTTGCCCATTTGCAGGCTGG - Intergenic
1179164913 21:38927790-38927812 AAGGGTGCCCATTTCCAGACTGG + Intergenic
1179231182 21:39505219-39505241 AGTGCTGCCACTTGCCAGGCAGG + Intronic
1179552697 21:42153591-42153613 AGCACTGTCCACTGCCAGGCTGG + Intergenic
1181447885 22:22992654-22992676 AACACTGCCCAATTCCAGGAAGG - Intergenic
1181643935 22:24220153-24220175 AGCTCAGCCCATCTCCAGGAGGG + Intronic
1182050773 22:27311042-27311064 AGCTCTGCCCATCCCCAGCCCGG - Intergenic
1184126638 22:42492006-42492028 AGCAGTGCCCATTCCCTGGCTGG + Intergenic
950551366 3:13668214-13668236 GCTGCTGCCCATTTCCAGGTGGG + Intergenic
951464585 3:22988623-22988645 AGTGCTGCCCTATTCTAGGCTGG - Intergenic
953070276 3:39513596-39513618 AGCCCTGCTCACCTCCAGGCAGG - Exonic
955549291 3:60066318-60066340 AGAGCTTCCCATTCCCAGGCTGG + Intronic
956520218 3:70095594-70095616 AGCTCTGCCAATTGCCAGGAAGG + Intergenic
957614418 3:82509140-82509162 AGCCCTGCCCCTTTCCAAGTTGG + Intergenic
961322255 3:126084067-126084089 AGCGCGGCCCTGTTCCGGGCGGG - Intronic
961447391 3:126987336-126987358 AGCGCTGCCCAGATCCTGGCGGG - Intergenic
961716634 3:128861957-128861979 AGCGCTGCCCAAGCCCAGGGTGG - Intergenic
962422181 3:135238440-135238462 GGCACTGCCACTTTCCAGGCAGG + Intronic
962530632 3:136277001-136277023 GGGGCTGCCCAACTCCAGGCTGG + Intronic
968143083 3:196274278-196274300 AGCCCTGCCCGTTTCCAAGTTGG - Intronic
968277690 3:197453380-197453402 TGCCATCCCCATTTCCAGGCCGG + Intergenic
971352858 4:25868315-25868337 TGAGCTGAACATTTCCAGGCAGG + Intronic
972172412 4:36362469-36362491 AGCTATACCCATTTCCAGGCAGG + Intergenic
974145621 4:57943843-57943865 AGCACTGCCTATATCCAGCCTGG + Intergenic
974923824 4:68273916-68273938 ATCACTGCCCATTTCCAGAAAGG - Intergenic
981023553 4:140053275-140053297 AGTGCCCCCCATTTCCAGGTTGG - Intronic
981284809 4:143004228-143004250 AGAGCTTCCCATATCCAGGTTGG + Intergenic
995708629 5:115012083-115012105 AGCGCTGCACATTTCTACTCAGG + Intergenic
1000949460 5:167462834-167462856 AGAGCTGCCAGTTTCCAGGCTGG + Intronic
1001998825 5:176183820-176183842 AACACTGCCCATTCTCAGGCAGG - Intergenic
1006919195 6:37616327-37616349 GCCCCTGCCCATCTCCAGGCAGG + Intergenic
1006985795 6:38174871-38174893 ACCTCTGCCCCTTTCCAGGGAGG - Exonic
1007686139 6:43668444-43668466 AGCACTGCCCCCTGCCAGGCGGG + Intronic
1011601602 6:89065125-89065147 AGCCCTGCCCCTGGCCAGGCGGG + Intergenic
1012829587 6:104187828-104187850 AGGGCTGCCACATTCCAGGCTGG - Intergenic
1013224930 6:108114012-108114034 ATCACCGCCCACTTCCAGGCGGG + Intronic
1020637469 7:10714148-10714170 CATGGTGCCCATTTCCAGGCAGG + Intergenic
1021801665 7:24313314-24313336 ATCCCTGCCCATTTCCAACCAGG + Intergenic
1022024146 7:26430217-26430239 AGCGCCAGCCATTTCCAGGGAGG + Intergenic
1022958196 7:35400575-35400597 AACTCTGCCCATTTCCAGAATGG - Intergenic
1026840910 7:73669498-73669520 AGCCCGGCCCATCTCCAGGCGGG - Exonic
1028517782 7:91697584-91697606 TGTGCTGCCCATATCCAGGTAGG + Intronic
1032541334 7:132705581-132705603 AGCCCTGTCCATTCCCTGGCTGG - Intronic
1034282450 7:149863692-149863714 ACCGCTGCCTCCTTCCAGGCAGG + Intronic
1034629615 7:152521038-152521060 AGCCCTGAGCTTTTCCAGGCAGG - Intergenic
1036214819 8:6870466-6870488 ATCACTCCCCTTTTCCAGGCAGG + Intergenic
1037905915 8:22715972-22715994 AGCGCTGCCCTTTTCCTGCCTGG - Intronic
1038473309 8:27843561-27843583 ACACCTGCCCATTGCCAGGCAGG - Intergenic
1039237187 8:35514462-35514484 AGCCCAGCGCATTTCTAGGCTGG + Intronic
1046101076 8:109614892-109614914 AGCCCTTCCTGTTTCCAGGCAGG - Intronic
1047732055 8:127736131-127736153 AGCCCTGCCCTTCTCGAGGCAGG - Exonic
1048300059 8:133244946-133244968 AGCGCTGCCCATTTCCAGGCTGG - Intronic
1051375775 9:16400923-16400945 AGGGCAGCCCATTCCTAGGCTGG - Intergenic
1051604502 9:18906866-18906888 AGCGCTGCCAGTTGGCAGGCCGG - Exonic
1055804840 9:80081245-80081267 TGAGGTGCCCATTTCCTGGCTGG - Intergenic
1055979701 9:81990000-81990022 TGCTCTGCCCATTTACGGGCAGG + Intronic
1059526867 9:115000157-115000179 AGCGCTGACAATTTGCAGACCGG - Intergenic
1060413737 9:123416342-123416364 AGCTCTGCCCATTACCAGCTGGG - Intronic
1190605583 X:52139179-52139201 AGCCCTTCCCATTGCCAGGCAGG + Intergenic
1193496370 X:82218901-82218923 ACCCCTGCTCATTGCCAGGCAGG - Intergenic
1199065929 X:143418131-143418153 AGGGCTGCCACATTCCAGGCTGG + Intergenic
1200215956 X:154368388-154368410 AGAGCTGCCCATCTGCAGGCTGG - Intronic