ID: 1048300060

View in Genome Browser
Species Human (GRCh38)
Location 8:133244950-133244972
Sequence CGTCAGCGCTGCCCATTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048300060_1048300068 -4 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300068 8:133244969-133244991 GACGGCAAGGGAGCAGGGGGAGG No data
1048300060_1048300069 2 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300069 8:133244975-133244997 AAGGGAGCAGGGGGAGGCTGCGG No data
1048300060_1048300073 8 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300073 8:133244981-133245003 GCAGGGGGAGGCTGCGGGGAGGG No data
1048300060_1048300080 28 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300080 8:133245001-133245023 GGGTGGCCTGGGGTGAAACGGGG No data
1048300060_1048300070 3 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300070 8:133244976-133244998 AGGGAGCAGGGGGAGGCTGCGGG No data
1048300060_1048300067 -7 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300067 8:133244966-133244988 GCTGACGGCAAGGGAGCAGGGGG No data
1048300060_1048300064 -10 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300064 8:133244963-133244985 AGCGCTGACGGCAAGGGAGCAGG No data
1048300060_1048300065 -9 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300065 8:133244964-133244986 GCGCTGACGGCAAGGGAGCAGGG No data
1048300060_1048300079 27 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300079 8:133245000-133245022 AGGGTGGCCTGGGGTGAAACGGG No data
1048300060_1048300071 4 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300071 8:133244977-133244999 GGGAGCAGGGGGAGGCTGCGGGG No data
1048300060_1048300075 16 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300075 8:133244989-133245011 AGGCTGCGGGGAGGGTGGCCTGG No data
1048300060_1048300072 7 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300072 8:133244980-133245002 AGCAGGGGGAGGCTGCGGGGAGG No data
1048300060_1048300077 18 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300077 8:133244991-133245013 GCTGCGGGGAGGGTGGCCTGGGG No data
1048300060_1048300074 11 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300074 8:133244984-133245006 GGGGGAGGCTGCGGGGAGGGTGG No data
1048300060_1048300066 -8 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data
1048300060_1048300076 17 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300076 8:133244990-133245012 GGCTGCGGGGAGGGTGGCCTGGG No data
1048300060_1048300078 26 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300078 8:133244999-133245021 GAGGGTGGCCTGGGGTGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048300060 Original CRISPR CGTCAGCGCTGCCCATTTCC AGG (reversed) Intronic
900393375 1:2443429-2443451 CGAGAGCGCTTCCCATCTCCAGG - Intronic
903848837 1:26294363-26294385 CGTCAGCTCAGCCCCTTCCCAGG + Intronic
905238279 1:36565405-36565427 CAACAGCACTGCCCATTGCCAGG - Intergenic
905300018 1:36980632-36980654 AGTCAGCTCTGCCCATTCCCAGG + Intronic
906516616 1:46442847-46442869 AGTCTGCGCTGACGATTTCCTGG + Intergenic
907428365 1:54395710-54395732 CGTCAGGGATCCTCATTTCCTGG - Intronic
913524819 1:119680621-119680643 AGTCAGTGCTGAGCATTTCCTGG + Intronic
914877192 1:151520748-151520770 GGTCAGCTCAGCCCATCTCCAGG - Intronic
915610969 1:156992373-156992395 CGTCAGTCCTGCCTATTTGCTGG + Intronic
920111393 1:203589783-203589805 CACCAGCTCTTCCCATTTCCTGG - Intergenic
920309138 1:205038364-205038386 CTTCAGCCCAGCCCACTTCCAGG + Intergenic
922543607 1:226437273-226437295 CGTCAGCTCTGCCCCCTCCCTGG + Intergenic
923596775 1:235366482-235366504 AGTCAGCACTCCCCATTCCCTGG - Intergenic
1062994003 10:1847729-1847751 CCTCAGTGCTGCCGTTTTCCCGG - Intergenic
1068568787 10:58605810-58605832 AGTCAGCGCTCCACATTCCCTGG - Intronic
1073382542 10:103090610-103090632 CTTCAGGGCTGCCCATGTCTTGG - Exonic
1077459313 11:2700707-2700729 CCTCGGCGCTGCCCTTTGCCAGG - Intronic
1079251696 11:18791877-18791899 CGCCAGCCCTGCGCAATTCCCGG - Intronic
1081760304 11:45572331-45572353 CCTCAGCTCTGCCCATTTCCTGG + Intergenic
1084060540 11:66670477-66670499 CCTCAGTGCTGGTCATTTCCTGG - Intronic
1086618182 11:88849847-88849869 CTTCAGTGCTGCCAAATTCCTGG + Intronic
1089494781 11:118902565-118902587 AGGCTGCGCTGCCCATTTCCAGG + Exonic
1090461022 11:126891747-126891769 CCCCAGCCCTGCCCATCTCCAGG - Intronic
1094128191 12:27045625-27045647 GGTTAGCTCTACCCATTTCCTGG - Intronic
1096473006 12:51890626-51890648 GGTCAGCACTGCCCATTCCAGGG - Exonic
1096578283 12:52568359-52568381 CGTCAGCGATGGCCGTCTCCAGG + Exonic
1096584454 12:52610805-52610827 CGTCAGCGATGGCCGTCTCCAGG + Exonic
1100254606 12:92870410-92870432 GGGAAGCGCTGCCCATTTTCAGG - Intronic
1105733374 13:23243341-23243363 CACCAGCACTGCACATTTCCCGG - Intronic
1111995528 13:95162621-95162643 CTTCAGCACTGCTCATCTCCTGG - Intronic
1114189628 14:20430447-20430469 CCTCAGCCCTGCCCGTTGCCTGG - Exonic
1119207136 14:72802868-72802890 CGTGATAGCTGCCCATGTCCAGG - Intronic
1121886834 14:97550730-97550752 CCTCAGCCCTGGGCATTTCCAGG - Intergenic
1127776950 15:62270943-62270965 AGCCAGCCCTGCCCCTTTCCTGG - Intergenic
1128615394 15:69104934-69104956 TGTTAGAGCTGCACATTTCCAGG + Intergenic
1129153278 15:73702553-73702575 CGGCAGCGCTGCCGAAATCCCGG - Exonic
1129153592 15:73703957-73703979 CGGCAGCGCTGCCGAAATCCCGG - Exonic
1138349070 16:56336879-56336901 CCTCAGCGCTGCCCCCTGCCCGG - Intronic
1138619207 16:58198061-58198083 CGCCGCCGCTGCCCCTTTCCCGG - Intergenic
1138659296 16:58508200-58508222 CCCCAGCTCTCCCCATTTCCAGG - Intronic
1139275673 16:65725398-65725420 GGTCAGGGTTGCCCAATTCCAGG + Intergenic
1142560719 17:807439-807461 AGGCAAAGCTGCCCATTTCCCGG + Intronic
1144960588 17:19042095-19042117 CCTCAGTGCTGCCCATCCCCTGG + Intronic
1144974572 17:19132429-19132451 CCTCAGTGCTGCCCATCCCCTGG - Intronic
1147482339 17:40778577-40778599 CGTCTGCCCTGCCCATGCCCCGG + Intronic
1148117112 17:45182598-45182620 CTTGAGCTCTGCCCATTTCCTGG - Intergenic
1149573564 17:57695342-57695364 TGTCTGCCCTGCCCCTTTCCTGG + Intergenic
1151139287 17:71976206-71976228 AAGCAGCGCTGCCCAGTTCCAGG + Intergenic
1152858225 17:82678754-82678776 CGTCAGCACCGGCCACTTCCAGG - Intronic
1153821245 18:8833930-8833952 CATCACCACTGCCCATTTCCAGG - Intergenic
1155254466 18:23982591-23982613 CGTCAGCGCTGGCCAATGTCCGG + Intergenic
1161989188 19:7674477-7674499 CCACAGCGTTGCACATTTCCCGG - Intergenic
1164578752 19:29421398-29421420 CGTCAGCCCTGATGATTTCCTGG + Intergenic
1168607168 19:57769517-57769539 CTTAAGCGCTGCCCATGTCTGGG + Intergenic
926098392 2:10097576-10097598 CGCCAGCGGTACACATTTCCAGG + Intergenic
927853692 2:26515051-26515073 GCTGAGCGCTGCCCATGTCCAGG - Intronic
928169577 2:28994828-28994850 CGTCACGGGTGCCCATGTCCTGG - Exonic
930976906 2:57474578-57474600 TGACAGAGCTGCCCATTTGCTGG + Intergenic
932456574 2:71853177-71853199 CCTCAGCGCTGCCCCTACCCAGG - Intergenic
932702578 2:74001828-74001850 CCTCAGGGCTTCCCATCTCCTGG - Intronic
937988833 2:127651107-127651129 CATCAGCGCCGACCGTTTCCTGG + Exonic
944947944 2:204712271-204712293 CATCAGAGCTTACCATTTCCAGG + Intronic
945182926 2:207110492-207110514 GGTCAGCTAGGCCCATTTCCTGG + Intronic
948102287 2:235384691-235384713 CGCCGGCGCTGCCCATGTCCAGG + Intergenic
1180321356 22:11324319-11324341 CCTCAGCGCAGACCATTTACAGG - Intergenic
1183938907 22:41281369-41281391 CATGTGAGCTGCCCATTTCCTGG + Exonic
961155421 3:124675713-124675735 CCTCAGGGCTGCCCAGTTGCAGG - Intronic
961447393 3:126987340-126987362 GGTCAGCGCTGCCCAGATCCTGG - Intergenic
961607546 3:128108037-128108059 CGCCAGCTCAGCCCCTTTCCTGG - Intronic
965539668 3:169859406-169859428 CGTCAGCTGCCCCCATTTCCAGG + Intronic
977231125 4:94452194-94452216 CTCCAGCGCTGCCCTTTTCCGGG - Intronic
981018903 4:140004685-140004707 CGTGAGCGCTGCGTTTTTCCTGG - Intronic
994885000 5:105549102-105549124 CCTCAGAGCTGCCCAACTCCAGG - Intergenic
999696374 5:154191140-154191162 CTTCAGCTCTTCCCATTTTCCGG + Intronic
1002366632 5:178717530-178717552 CCTCAGCCTTGCCCCTTTCCTGG - Intronic
1002908862 6:1472559-1472581 CGTCACCACCACCCATTTCCAGG - Intergenic
1015198834 6:130555065-130555087 CCACAGCGCTGCACAATTCCAGG - Intergenic
1019143570 6:169962826-169962848 GGGCAGCGCAGCCCCTTTCCCGG - Intergenic
1019669895 7:2271820-2271842 TGTCTGCCCTGCCCATGTCCCGG - Intronic
1024984402 7:55182733-55182755 CATGAGCGCTCCCCACTTCCTGG - Intronic
1025090448 7:56058832-56058854 CGTCAGCACTGTCCATCTCTAGG + Intronic
1025902596 7:65758459-65758481 CGTCAGCACTGTCCATCTCTAGG + Intergenic
1030561647 7:111094291-111094313 CCTCACCTCTGCCCATTTTCAGG - Intronic
1034349803 7:150408325-150408347 AGCCAGCGCTGCCCCTCTCCCGG - Intronic
1034767070 7:153733909-153733931 CTCCATCGCTGCCCATTCCCAGG - Intergenic
1035790185 8:2297243-2297265 CGTGAGCCCTGCCCTTTGCCAGG + Intergenic
1035802620 8:2424462-2424484 CGTGAGCCCTGCCCTTTGCCAGG - Intergenic
1038332010 8:26616580-26616602 TATCAGCACTGCCCATCTCCAGG - Intronic
1039889395 8:41673916-41673938 GGGCAGCCCTGCCCATTCCCAGG - Intronic
1039981332 8:42411719-42411741 AGTCAGCTCTGCCCCTCTCCGGG + Intergenic
1040913249 8:52542585-52542607 CTCCAGCCCTGACCATTTCCTGG + Intronic
1048194982 8:132325090-132325112 CGTCAGCTCTGCCCACTCCAGGG - Intronic
1048300060 8:133244950-133244972 CGTCAGCGCTGCCCATTTCCAGG - Intronic
1048584068 8:135756428-135756450 CTGCAGCTCTTCCCATTTCCTGG + Intergenic
1049014384 8:139909221-139909243 CATCAGAGCTGCCCCTTCCCCGG + Intronic
1057131329 9:92656390-92656412 CATCAACACTGCCAATTTCCCGG - Intronic
1057445631 9:95112530-95112552 CATCAGCTCTGACCATGTCCTGG - Intronic
1060659695 9:125397442-125397464 TGTCTGCGCTGCCCCTTCCCCGG + Intergenic
1062496466 9:136833737-136833759 CGACAGCACAGCCCCTTTCCTGG - Intronic