ID: 1048300066

View in Genome Browser
Species Human (GRCh38)
Location 8:133244965-133244987
Sequence CGCTGACGGCAAGGGAGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048300060_1048300066 -8 Left 1048300060 8:133244950-133244972 CCTGGAAATGGGCAGCGCTGACG 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data
1048300055_1048300066 22 Left 1048300055 8:133244920-133244942 CCATTGCAGGCTGTGAGACTGTG 0: 1
1: 1
2: 3
3: 32
4: 360
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data
1048300059_1048300066 -4 Left 1048300059 8:133244946-133244968 CCAGCCTGGAAATGGGCAGCGCT 0: 1
1: 1
2: 1
3: 20
4: 156
Right 1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048300066 Original CRISPR CGCTGACGGCAAGGGAGCAG GGG Intronic
No off target data available for this crispr