ID: 1048300149

View in Genome Browser
Species Human (GRCh38)
Location 8:133245372-133245394
Sequence CTGTGGCTATACTTGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048300146_1048300149 -10 Left 1048300146 8:133245359-133245381 CCAGTACCTATCACTGTGGCTAT 0: 1
1: 0
2: 1
3: 25
4: 204
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300139_1048300149 20 Left 1048300139 8:133245329-133245351 CCCCAAAATAGACATACTGAAGT 0: 1
1: 0
2: 3
3: 62
4: 585
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300144_1048300149 -8 Left 1048300144 8:133245357-133245379 CCCCAGTACCTATCACTGTGGCT 0: 1
1: 0
2: 4
3: 66
4: 592
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300145_1048300149 -9 Left 1048300145 8:133245358-133245380 CCCAGTACCTATCACTGTGGCTA 0: 1
1: 0
2: 1
3: 36
4: 337
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300141_1048300149 18 Left 1048300141 8:133245331-133245353 CCAAAATAGACATACTGAAGTCC 0: 1
1: 0
2: 8
3: 95
4: 570
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300142_1048300149 -3 Left 1048300142 8:133245352-133245374 CCTAACCCCAGTACCTATCACTG 0: 1
1: 0
2: 2
3: 32
4: 274
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data
1048300140_1048300149 19 Left 1048300140 8:133245330-133245352 CCCAAAATAGACATACTGAAGTC 0: 1
1: 0
2: 2
3: 67
4: 530
Right 1048300149 8:133245372-133245394 CTGTGGCTATACTTGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048300149 Original CRISPR CTGTGGCTATACTTGGAAAT AGG Intronic
No off target data available for this crispr