ID: 1048301295

View in Genome Browser
Species Human (GRCh38)
Location 8:133253131-133253153
Sequence ATACCCTTCCCGAGGGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048301290_1048301295 -10 Left 1048301290 8:133253118-133253140 CCAAGCCCATGGCATACCCTTCC 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG No data
1048301287_1048301295 4 Left 1048301287 8:133253104-133253126 CCCTGGGCTTGCAACCAAGCCCA 0: 1
1: 0
2: 2
3: 13
4: 171
Right 1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG No data
1048301288_1048301295 3 Left 1048301288 8:133253105-133253127 CCTGGGCTTGCAACCAAGCCCAT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG No data
1048301283_1048301295 21 Left 1048301283 8:133253087-133253109 CCAAGGGGTTTTCCAGACCCTGG 0: 1
1: 0
2: 4
3: 20
4: 190
Right 1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG No data
1048301286_1048301295 9 Left 1048301286 8:133253099-133253121 CCAGACCCTGGGCTTGCAACCAA 0: 1
1: 0
2: 1
3: 9
4: 171
Right 1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048301295 Original CRISPR ATACCCTTCCCGAGGGTAGC TGG Intronic
No off target data available for this crispr