ID: 1048301804

View in Genome Browser
Species Human (GRCh38)
Location 8:133256765-133256787
Sequence CCGCCTCCAAGGTGAGGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048301804_1048301819 21 Left 1048301804 8:133256765-133256787 CCCCCACCTCACCTTGGAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1048301819 8:133256809-133256831 CACAAGGGTTCACGTTGATAAGG 0: 1
1: 0
2: 0
3: 1
4: 58
1048301804_1048301815 6 Left 1048301804 8:133256765-133256787 CCCCCACCTCACCTTGGAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1048301815 8:133256794-133256816 CCATCCAGCCTTCCGCACAAGGG 0: 1
1: 0
2: 1
3: 9
4: 103
1048301804_1048301813 5 Left 1048301804 8:133256765-133256787 CCCCCACCTCACCTTGGAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1048301813 8:133256793-133256815 TCCATCCAGCCTTCCGCACAAGG 0: 1
1: 1
2: 0
3: 10
4: 139
1048301804_1048301820 27 Left 1048301804 8:133256765-133256787 CCCCCACCTCACCTTGGAGGCGG 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1048301820 8:133256815-133256837 GGTTCACGTTGATAAGGACAAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048301804 Original CRISPR CCGCCTCCAAGGTGAGGTGG GGG (reversed) Exonic
900267188 1:1763788-1763810 GCGCCTTCAGGGTGAGGTGGGGG - Intronic
900547509 1:3236903-3236925 AGGCCTCCATGGTGAGGTGGAGG - Intronic
900703475 1:4061982-4062004 CCGCCACCAGGGTGACATGGAGG + Intergenic
901160895 1:7176033-7176055 ATACCTCCAAGGTCAGGTGGTGG - Intronic
902231303 1:15029456-15029478 CTGCCTCCATGGTGGGGTGCAGG - Intronic
902559253 1:17266826-17266848 CTGCCTGCAAGGTGAGGCCGGGG + Exonic
903335063 1:22619144-22619166 CCACCTTCATGGAGAGGTGGAGG + Intergenic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
912620816 1:111155621-111155643 TCGCCTCCCAGGTGAGGCGGAGG - Intronic
912966702 1:114242623-114242645 CCACCTCCCAGATGGGGTGGCGG - Intergenic
913191760 1:116418797-116418819 CCGCGCCCAAGCTCAGGTGGCGG - Intergenic
916668400 1:166989139-166989161 CCGCCTTGCGGGTGAGGTGGGGG - Exonic
918509398 1:185293903-185293925 AAGCCTGGAAGGTGAGGTGGTGG + Intergenic
921560949 1:216657670-216657692 CCACCTGCCAGGTGAGGTTGTGG + Intronic
922466079 1:225846187-225846209 CTCCCTCCAAGGTGTGGGGGTGG - Exonic
924931971 1:248740069-248740091 CTTCCTCCAGGGTCAGGTGGCGG - Intronic
1063620307 10:7641267-7641289 CCTCCTCCATGGTGAAGTTGAGG - Intronic
1065025087 10:21534083-21534105 CCGCCGCCGAGGTGTGCTGGGGG - Intergenic
1067334406 10:45348383-45348405 TCGCCTCCGAGGCGGGGTGGCGG - Intergenic
1071532467 10:86400620-86400642 CCGCCTGGAAGGTGAGGGTGTGG - Intergenic
1073143882 10:101266582-101266604 CCGTGTCCAATGGGAGGTGGGGG + Intergenic
1075793312 10:125101448-125101470 CCGCAGCCAAGGCGAGGTGCTGG - Intronic
1076282387 10:129259203-129259225 CTGCCTCCCTGTTGAGGTGGTGG - Intergenic
1076325136 10:129615302-129615324 ACGCCTCCCTGGTGAGGTGTGGG + Intronic
1076369049 10:129940227-129940249 GGGCCTGCAAGGTGAGGAGGAGG - Intronic
1076685954 10:132198593-132198615 ACGCCTCCCAGATGAGGTCGGGG - Intronic
1076988795 11:258192-258214 CCGCCTCCCAGGTGCGTTAGGGG - Intergenic
1083204964 11:61143191-61143213 CAGCCTCCCCTGTGAGGTGGGGG - Intronic
1084147842 11:67274563-67274585 CCACCTCCCAGGTGAGATGCAGG + Intronic
1084487052 11:69454632-69454654 CTGTCTCAAAGGAGAGGTGGGGG - Intergenic
1084844580 11:71889012-71889034 CAACCCCCAAGGAGAGGTGGAGG + Intronic
1090360912 11:126171994-126172016 CTGCCTCCAGGAGGAGGTGGAGG - Intergenic
1092389141 12:8059981-8060003 GGTCCGCCAAGGTGAGGTGGAGG + Exonic
1094059455 12:26298030-26298052 ACTCCTCCTAGGTGATGTGGGGG - Intronic
1096631306 12:52928397-52928419 CCACCTCCAAGGGGAGGTAAGGG - Intronic
1097261910 12:57725246-57725268 CTGCCTCCAAGGAGATGGGGGGG + Intronic
1098130088 12:67341223-67341245 ACACCTCCCAGGTGGGGTGGCGG + Intergenic
1101108570 12:101463381-101463403 CAGCCTCCGAAGTGAGGAGGAGG - Intergenic
1101835048 12:108289175-108289197 CTGCCTCCTGGGTGGGGTGGGGG - Exonic
1103649914 12:122423801-122423823 CAGGCTGCAAGGTCAGGTGGTGG + Intergenic
1105997136 13:25683245-25683267 CAACATCCAAGGTGAGGTTGTGG + Intronic
1119051816 14:71377205-71377227 CCACCTCCCAGATGGGGTGGCGG + Intronic
1121422313 14:93824464-93824486 CTGCCTCCAGGGAGATGTGGGGG + Intergenic
1121798874 14:96756894-96756916 CCCCATCCAAGGTGTGGTGGGGG + Intergenic
1122159643 14:99773929-99773951 CCTCCTCCAAGGGGAGATGCGGG - Intronic
1122190134 14:100035862-100035884 CTGCCCCCTAGGTGAGGTGGGGG - Intronic
1122557793 14:102591124-102591146 CCCCCACCAAGTTCAGGTGGGGG - Intergenic
1122691094 14:103532487-103532509 GGGTCTCCAGGGTGAGGTGGGGG + Intronic
1127088423 15:55445794-55445816 CCGCTTCCCAGATGGGGTGGCGG + Intronic
1127088499 15:55446056-55446078 CCGCTTCCCAGATGGGGTGGCGG + Intronic
1128147537 15:65340273-65340295 CAGGCTCCAGGGGGAGGTGGGGG + Intronic
1128227017 15:66008977-66008999 CTGCCTGCCAGGTGAGCTGGAGG + Intronic
1132634710 16:938106-938128 CCGCCTCGCAGGAGAGGGGGTGG + Intronic
1132908737 16:2297754-2297776 CAGGCTCCAAGGTGTGGCGGTGG - Exonic
1132920326 16:2386246-2386268 CAGGCTCCAAGGTGCGGCGGTGG + Intergenic
1132942941 16:2517300-2517322 GCACCTCCAAGGTGGCGTGGAGG + Intronic
1132995516 16:2820488-2820510 CCGCCTCCCAGGGGTGCTGGGGG + Intronic
1134317702 16:13134585-13134607 CCGGAGCAAAGGTGAGGTGGAGG + Intronic
1134345385 16:13386338-13386360 ACACTTCCAGGGTGAGGTGGAGG - Intergenic
1135597751 16:23756299-23756321 CCTCCTCCAAGGTGGGGGGAAGG + Intronic
1136276613 16:29182651-29182673 CCGCCACCAAGGCAGGGTGGTGG - Intergenic
1137388209 16:48059598-48059620 CCTCTTCCCAGGTGCGGTGGTGG + Intergenic
1137444922 16:48525886-48525908 CCGCCTCCAAGGAGAGATGGCGG - Intergenic
1141521610 16:84583838-84583860 CTGCCTCCAAGGAGAAGTGGAGG - Intronic
1141776669 16:86127736-86127758 TCTCCTCCAAGCAGAGGTGGGGG + Intergenic
1142080995 16:88148712-88148734 CCGCCACCAAGGCAGGGTGGTGG - Intergenic
1142435186 16:90052316-90052338 CGACCTCCAAGGTGAAGTAGCGG + Intergenic
1142607525 17:1090378-1090400 TCCCCTCTAAGGAGAGGTGGGGG + Intronic
1143367231 17:6416086-6416108 CCTCCTCCAGGGTAAGGTGAGGG - Intronic
1144776489 17:17787586-17787608 CCACCTCCACTGTGAGGTGTGGG - Intronic
1146176184 17:30667801-30667823 CCGCCTGCGGGGTGGGGTGGGGG + Intergenic
1146349642 17:32083912-32083934 CCGCCTGCGGGGTGGGGTGGGGG + Intergenic
1149461772 17:56834495-56834517 CCGGCGGCAAGGTGAGGCGGCGG + Intronic
1151584715 17:75002082-75002104 GCGCCTCCAGGCTCAGGTGGAGG + Exonic
1151826089 17:76525204-76525226 CCGCCTCCATCGTCGGGTGGGGG + Intergenic
1154120462 18:11647917-11647939 TCACCTCCAAGATGGGGTGGTGG - Intergenic
1156012649 18:32512522-32512544 CCCCCTCCTAGGTGAGATGAAGG + Intergenic
1158089389 18:53692980-53693002 CCACCTCCCAGGTGAGGCTGAGG + Intergenic
1160546246 18:79657835-79657857 CTGCGGCCCAGGTGAGGTGGAGG + Intergenic
1165097274 19:33416528-33416550 CCGCCTTCCAGGTGAGCAGGAGG - Intronic
1165321978 19:35091110-35091132 CCTCCTACCAGGTGAGCTGGGGG + Intergenic
1166782696 19:45350712-45350734 CCGGCTCCGAGGCGAGGCGGCGG + Exonic
1167465840 19:49650905-49650927 CCGTGCCCAAGGTGAGGTGACGG - Exonic
1167551403 19:50163236-50163258 CCGCCTCCCAGGCGAGGGCGCGG + Intergenic
1168165302 19:54543122-54543144 CCTCCCCAGAGGTGAGGTGGAGG - Intronic
926428730 2:12764558-12764580 CAGCCTCCAAGGGGAAGTGGTGG - Intergenic
932428662 2:71660008-71660030 CGGCCTCCAAGGTGTGGTCATGG + Intronic
935345501 2:102104120-102104142 CCACCTCCAGGGTGTGGTGAAGG + Intronic
937624127 2:124024892-124024914 CCCCTCCAAAGGTGAGGTGGGGG + Intergenic
938371538 2:130771657-130771679 ACCCCTGCAAGGGGAGGTGGGGG + Intergenic
941227541 2:162867850-162867872 CCGCTTCCAAGGGGTGGGGGAGG - Intergenic
945040582 2:205740653-205740675 CCGGGTCACAGGTGAGGTGGGGG + Exonic
946209358 2:218135115-218135137 CCGCCTCCAAGGTGAATGGCTGG + Exonic
946213371 2:218164903-218164925 CCGCCTCCAAGGTGAATGGCTGG - Exonic
948756438 2:240162226-240162248 CCTCCTCCAGGGTCAGGGGGTGG - Intergenic
948776306 2:240290597-240290619 ACGCCTCCAGGGTGTGGTGGCGG - Intergenic
948943857 2:241209700-241209722 ACGGCACCAAGGTGAGATGGGGG - Intronic
1170624980 20:18023460-18023482 AGGCCTCCAAGGTGAGGAGATGG + Intronic
1171031954 20:21684848-21684870 CCGCCTCCTAGTGGAGGTAGTGG + Intergenic
1172011753 20:31849737-31849759 CCTGCTGCAACGTGAGGTGGCGG + Intronic
1172908867 20:38390622-38390644 CAGACTTCAAGGTGGGGTGGGGG + Intergenic
1175137798 20:56838112-56838134 CCTCCTCCAAGGTGTGATGAAGG + Intergenic
1176021307 20:62963670-62963692 CCGACGCCAAGGTGAGTCGGGGG + Exonic
1176085726 20:63294635-63294657 CCGCCTCCAGGGCGAGGCTGGGG + Intronic
1176705588 21:10118387-10118409 CCAGCCCCAAGATGAGGTGGTGG + Intergenic
1178907648 21:36649939-36649961 CCGCCTCCAAGGTTAGCCTGTGG - Intergenic
1180103307 21:45600091-45600113 CAGCCTCCAATGTCAGGAGGAGG - Intergenic
1181113502 22:20616328-20616350 CCGCCTCCCAGGAGATCTGGAGG - Intergenic
1183226111 22:36551024-36551046 CCTCCTACAAGGAGAGGTGGAGG - Intergenic
950359586 3:12441007-12441029 CCACCTCCAAGGGGAGGGGAGGG + Intergenic
953341723 3:42140189-42140211 CCACCTCCAGGGGAAGGTGGGGG - Intronic
954566949 3:51607776-51607798 CCACCTCCCAGATGGGGTGGCGG + Intronic
962375567 3:134856145-134856167 CCAACCCCAAGGTGGGGTGGTGG - Intronic
966967006 3:185004060-185004082 CCACCTCCCAGATGGGGTGGCGG + Intronic
968485607 4:859594-859616 CGGCCTCCAAGGTAACGTGGAGG - Exonic
969348073 4:6581621-6581643 GCTCCACCAAGGTGAGATGGAGG - Intronic
969505917 4:7587661-7587683 TCGCCTCCCAGGGGAGGTAGGGG + Intronic
969718315 4:8879083-8879105 CCGCCTCCGATGTTGGGTGGGGG - Intergenic
973258421 4:48136396-48136418 CCGGGTCCTATGTGAGGTGGGGG + Exonic
977348994 4:95856481-95856503 CCAACTCAAAGGTGAGGAGGTGG + Intergenic
979941831 4:126771484-126771506 CCACCTCCCAGACGAGGTGGCGG - Intergenic
982268285 4:153560268-153560290 CTGCTTCCCAGGTGAGGTGCAGG - Intronic
986141373 5:5033649-5033671 CCGGCTCCATGGAGAGGTGACGG + Intergenic
987025119 5:13919018-13919040 CAGCCTCCAAAGTGATGTGAGGG + Intronic
989356729 5:40551770-40551792 CCGTCTGCAAGGTGAGGAGTGGG - Intergenic
989655745 5:43745766-43745788 CCACCTCCCAGATGGGGTGGTGG + Intergenic
991935207 5:71794035-71794057 CCACCTCCCAGATGGGGTGGCGG + Intergenic
993494747 5:88595184-88595206 CTGCCTCCTAGGTGAGGTCAGGG - Intergenic
997513467 5:134468398-134468420 CTGCCTCCCAGCTGAGGTGCAGG - Intergenic
997976567 5:138444857-138444879 CTGCCGCCAAGGTGAGATGGGGG + Exonic
999315867 5:150583687-150583709 CACCTTCCAAGGTGGGGTGGGGG - Intergenic
999737251 5:154521977-154521999 CCCCCACAAAGGGGAGGTGGGGG + Intergenic
1001480040 5:172082231-172082253 CTGCTGCCAAGGTGAGGTTGAGG + Intronic
1003139037 6:3456378-3456400 CCGCCTCCAGGATGCAGTGGGGG + Exonic
1005465440 6:26108205-26108227 CCTCCTCCAAGGGGCGGGGGCGG - Intergenic
1007037987 6:38695620-38695642 CCCCTGCCAAGGTGATGTGGGGG - Intronic
1008408785 6:51148727-51148749 CCTCCTGTAAGTTGAGGTGGTGG + Intergenic
1009049121 6:58257981-58258003 CCACCTCCCAGATGAGGTGGCGG - Intergenic
1011497459 6:87950549-87950571 CCACCATCAAGGTGATGTGGTGG - Intergenic
1013240594 6:108241699-108241721 CCTCCCCAAAGGGGAGGTGGTGG - Intronic
1017788343 6:157774446-157774468 GGGCTTCCAAGGTGAAGTGGAGG + Intronic
1019481871 7:1270622-1270644 CCTTTTCCCAGGTGAGGTGGAGG + Intergenic
1019923592 7:4178370-4178392 CACCCTCCAAGGAGAGGAGGCGG - Intronic
1022108343 7:27212797-27212819 GCCCCTCCGAGGTGGGGTGGGGG + Intergenic
1023150376 7:37196249-37196271 CAGCCTCGAGGCTGAGGTGGGGG + Intronic
1024625950 7:51208539-51208561 ACGCCTCCCAGATGGGGTGGTGG - Intronic
1025035473 7:55590519-55590541 TCTCCTCCAGGATGAGGTGGGGG + Intergenic
1026610497 7:71855449-71855471 GGGCTTCCAAGTTGAGGTGGGGG - Intronic
1026772934 7:73213572-73213594 CTGCCTCCAAGGTGCGGGGCAGG - Intergenic
1027013797 7:74766968-74766990 CTGCCTCCAAGGTGCGGGGCAGG - Intergenic
1027074241 7:75179064-75179086 CTGCCTCCAAGGTGCGGGGCAGG + Intergenic
1027826799 7:83125368-83125390 CCACCTCCCAGATGGGGTGGTGG - Intronic
1028193306 7:87876537-87876559 CCGGCTCCAAGGCGCGGAGGAGG - Exonic
1028637053 7:93000947-93000969 CAGTCTCCACGGTGAGTTGGAGG - Intergenic
1030288399 7:107848524-107848546 ACACCTCCCAGATGAGGTGGCGG - Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035726667 8:1829071-1829093 CCGCCCCCCAGGTGTGCTGGAGG - Intronic
1037891843 8:22627768-22627790 CAGCCTCCGAGGCCAGGTGGGGG + Intronic
1039416241 8:37396795-37396817 TCCCCTTCTAGGTGAGGTGGGGG + Intergenic
1039547527 8:38420730-38420752 CCGCCTCCATGGTTGGCTGGTGG - Intronic
1040512277 8:48105812-48105834 CTCCCTGCAAGGTGAGGTGATGG + Intergenic
1042304496 8:67316954-67316976 CCACCTCCAAGGAGGGGAGGGGG + Intronic
1044223970 8:89699607-89699629 ACGCCTCCCAGATGGGGTGGTGG - Intergenic
1046094304 8:109539654-109539676 CCGCCTTCAAGGAGGGCTGGGGG + Intergenic
1047029310 8:120859788-120859810 CCGCATCCAAGGGCAGATGGAGG - Intergenic
1048269896 8:133020267-133020289 CCTCCTCCAAGGTCAGGATGGGG - Intronic
1048301804 8:133256765-133256787 CCGCCTCCAAGGTGAGGTGGGGG - Exonic
1048354060 8:133639177-133639199 CCTCCTTCAAGTAGAGGTGGCGG + Intergenic
1049441495 8:142611791-142611813 CAGCCTGCAAGGTGAGGGGTGGG + Exonic
1049583529 8:143423043-143423065 CCGCCTCCCAGGTGAGGAAGCGG + Intronic
1049708230 8:144052437-144052459 CCGCCTCCCAGGTGCGGGGGCGG - Exonic
1052259130 9:26492835-26492857 TCGCCTCCCAGATGGGGTGGTGG - Intergenic
1052928805 9:34039331-34039353 ACACCTCCCAGATGAGGTGGCGG - Intronic
1053081901 9:35183908-35183930 TCGCCTCCAAGACGGGGTGGCGG + Intronic
1053642868 9:40105511-40105533 CCAGCCCCAAGATGAGGTGGTGG + Intergenic
1053763285 9:41359979-41360001 CCAGCCCCAAGATGAGGTGGTGG - Intergenic
1054323726 9:63702762-63702784 CCAGCCCCAAGATGAGGTGGTGG + Intergenic
1054541894 9:66271146-66271168 CCAGCCCCAAGATGAGGTGGTGG - Intergenic
1057913374 9:99036952-99036974 CCCCCTCCGTGGTGAGGTGGAGG - Intronic
1059217741 9:112581825-112581847 ACACCACCAAGGTGAGGTGAAGG + Intronic
1060355738 9:122905325-122905347 CCGCCTCCGTGGTGAGGAGGAGG - Intronic
1060627431 9:125126371-125126393 CCTCCCCCAAAGTGAGTTGGGGG + Intronic
1060724029 9:125995648-125995670 CTACCTCCAAGGTGGGGTGAGGG - Intergenic
1061009020 9:127944420-127944442 CAGGCTCCCAGGTGAGGTGGTGG + Intronic
1062581686 9:137231732-137231754 CCGCGTCCAGAGTGGGGTGGGGG - Exonic
1202790621 9_KI270719v1_random:88496-88518 CCAGCCCCAAGATGAGGTGGTGG + Intergenic
1192118596 X:68433943-68433965 CAGCCTCCCAGGCGGGGTGGTGG - Intergenic
1194688952 X:96958026-96958048 ACTCCTCCAAGGGGTGGTGGTGG - Exonic
1197766942 X:130065524-130065546 CCGCCTTCGAGGTGAGTTGCAGG + Exonic
1197773432 X:130105325-130105347 CTGCTTCCAGGGTGAGGAGGAGG - Intronic
1200162875 X:154018359-154018381 CAGCCCCCAGGGTGCGGTGGGGG + Intronic