ID: 1048302282

View in Genome Browser
Species Human (GRCh38)
Location 8:133260407-133260429
Sequence GGTGGGACCCACTGTCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048302282_1048302289 12 Left 1048302282 8:133260407-133260429 CCACTCTGACAGTGGGTCCCACC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1048302289 8:133260442-133260464 AAACCACATAGTAAACTAGGGGG No data
1048302282_1048302286 9 Left 1048302282 8:133260407-133260429 CCACTCTGACAGTGGGTCCCACC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1048302286 8:133260439-133260461 CGAAAACCACATAGTAAACTAGG No data
1048302282_1048302288 11 Left 1048302282 8:133260407-133260429 CCACTCTGACAGTGGGTCCCACC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1048302288 8:133260441-133260463 AAAACCACATAGTAAACTAGGGG No data
1048302282_1048302287 10 Left 1048302282 8:133260407-133260429 CCACTCTGACAGTGGGTCCCACC 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1048302287 8:133260440-133260462 GAAAACCACATAGTAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048302282 Original CRISPR GGTGGGACCCACTGTCAGAG TGG (reversed) Intronic
900606044 1:3523989-3524011 GGAAGGAGCCACTGCCAGAGCGG + Intronic
902635159 1:17730034-17730056 GGTGGGAGCCACTGGCAGCGGGG - Intergenic
904412528 1:30333052-30333074 GTGGGGACCCACTGACTGAGAGG + Intergenic
905867702 1:41385219-41385241 GGAGGGACCCACTGGCTGAGAGG + Intergenic
906248165 1:44291703-44291725 TGTGGGACTCTCTGTCTGAGGGG - Intronic
912511710 1:110194457-110194479 GGTGGGAACCCCTGTGAAAGAGG + Intronic
918942994 1:191026280-191026302 GGCGGGCCCCACACTCAGAGCGG - Intergenic
919803554 1:201367545-201367567 GGTGGCACCCAGTGGGAGAGGGG - Intronic
920304269 1:205008752-205008774 AGAGGGACTCACTGTCACAGGGG + Intronic
920395805 1:205645070-205645092 GGAGGGGCCCAGTCTCAGAGGGG - Intergenic
922090785 1:222393289-222393311 GGTGGGTCACACAGCCAGAGAGG + Intergenic
922249304 1:223833014-223833036 GTTGGGACCCATCGTCAGGGAGG - Intronic
1062881164 10:979503-979525 GGTGGGAGCCACAGCCATAGAGG - Intergenic
1063256157 10:4329534-4329556 GCTGGGAACCAGTGTCAGAAAGG - Intergenic
1064729927 10:18319896-18319918 GGTGGGACCCAAGAACAGAGAGG + Intronic
1069661137 10:70124150-70124172 GGGAGGACCCACAGTGAGAGAGG + Intronic
1069807428 10:71134706-71134728 GGTGGGGCCCAGGGACAGAGAGG - Intergenic
1072817543 10:98524399-98524421 GGTGGGGCTGACTGTCCGAGAGG + Intronic
1075835033 10:125445648-125445670 GGTGGGACCCAGTGGCTGTGGGG - Intergenic
1076729608 10:132431862-132431884 CGTGGGACCCTGTCTCAGAGAGG - Intergenic
1077234068 11:1471464-1471486 GGTGGGACCCAGTGGCTGGGTGG - Intronic
1077843887 11:6003671-6003693 GGTGGGGGCCACTGTCTGTGTGG - Intergenic
1079040230 11:17052768-17052790 GGTGAGACCCACAGGCAGAGAGG - Intergenic
1080046153 11:27810308-27810330 AATGAGACCCACTGGCAGAGAGG + Intergenic
1083141050 11:60722267-60722289 GGTAGGAGCCATTGACAGAGAGG - Intergenic
1083803094 11:65057986-65058008 AGTGGGGCCCACTGTTGGAGGGG + Exonic
1084831726 11:71774810-71774832 GGTGGGCCCCGCACTCAGAGCGG + Intergenic
1087441201 11:98185504-98185526 GGTGGGCCCCGCACTCAGAGTGG - Intergenic
1089616907 11:119699946-119699968 GGTGGTTCCCACTTTAAGAGGGG - Intronic
1089702252 11:120252516-120252538 GGTGGGAGCCACTCTGAGAAGGG - Intronic
1091820292 12:3470948-3470970 GGAAAGCCCCACTGTCAGAGTGG - Intronic
1092006037 12:5071278-5071300 GCTGGGACTCAGTGTCCGAGAGG - Intergenic
1094010088 12:25798903-25798925 GCTGTGATCCACTGTCAGAATGG - Intergenic
1095444974 12:42273988-42274010 GGTGGGCCCCACACTCGGAGGGG - Intronic
1096414316 12:51400434-51400456 GTTGGGACCCACTGCCAGGCAGG + Intronic
1097066221 12:56322748-56322770 GCTGGGCCCCACTGTGAGGGGGG + Exonic
1098498783 12:71166495-71166517 GGTGGGCCCCACACTCGGAGTGG - Intronic
1099192425 12:79573993-79574015 GGTGGGCCCCGCACTCAGAGTGG + Intergenic
1101489358 12:105197173-105197195 AGTGGGATCCCCTCTCAGAGTGG - Intronic
1102018296 12:109663330-109663352 GCTGGAGCCCACCGTCAGAGAGG - Intergenic
1103351501 12:120286836-120286858 GATGAGACCCACTACCAGAGAGG - Intergenic
1107768967 13:43769300-43769322 GTGGGGACCCAGTGGCAGAGGGG - Intronic
1108783770 13:53869307-53869329 TATGGGAACCACTGTCACAGGGG + Intergenic
1112379960 13:98879275-98879297 GGGGGGACCCACGGTCAGAAAGG + Intronic
1112457569 13:99576222-99576244 GGCGTGACTCACTGGCAGAGAGG + Intergenic
1114416195 14:22546225-22546247 GGTGGGCTCCATGGTCAGAGGGG - Intergenic
1115118263 14:29909071-29909093 GGCGGGCCCCACACTCAGAGTGG + Intronic
1115516273 14:34188185-34188207 TGTGGGAGCCACTGTCCAAGAGG - Intronic
1116152146 14:41154525-41154547 GGCGGGCCCCACACTCAGAGCGG - Intergenic
1117347970 14:54852597-54852619 GCTGGGACCCACTGTCTGTGTGG - Intronic
1118170470 14:63384076-63384098 GGATGGACCCACTGTCTGAAAGG + Intronic
1119769315 14:77210617-77210639 GGAGGGACCCCCTCTCAGTGAGG - Intronic
1120032939 14:79663296-79663318 GTTAGGAGCCAATGTCAGAGGGG - Intronic
1125059350 15:35400630-35400652 GGTGGCATCCACTGGCAGAAAGG - Intronic
1125591452 15:40856967-40856989 GGTGAGACCCAGGCTCAGAGGGG - Exonic
1125712640 15:41799296-41799318 GGTGGAGCCCTCTGACAGAGGGG + Intronic
1125928465 15:43582787-43582809 CGGGGAACCCACTGTGAGAGGGG - Intronic
1125941631 15:43682622-43682644 CGGGGAACCCACTGTGAGAGGGG - Intergenic
1128624552 15:69186235-69186257 CTTAAGACCCACTGTCAGAGAGG + Intronic
1128664995 15:69531501-69531523 GGTGGCACCCCCTGCCCGAGAGG - Intergenic
1128989787 15:72250082-72250104 TGTGGGACCCACTGTAAGGCAGG + Exonic
1129231135 15:74197740-74197762 GGTTGGACTCACTGACAGCGAGG + Exonic
1131389262 15:92033938-92033960 GGTGGGACCCAGTGAGGGAGGGG + Intronic
1132550055 16:550621-550643 AGTGAGACCCCCTGTCAGTGAGG + Intronic
1134240692 16:12503711-12503733 TGTAGGATTCACTGTCAGAGAGG + Intronic
1136004240 16:27317584-27317606 TGGGGGATCCACTGTCAGACCGG + Intronic
1136232554 16:28895109-28895131 GGTGGGACCCATTGTCCCTGGGG + Intronic
1136356626 16:29748432-29748454 GGTGGGCCCCGCACTCAGAGAGG + Intergenic
1137643672 16:50056064-50056086 GGTGGGTACCACTGACAGTGTGG - Intergenic
1137671014 16:50279221-50279243 TGCTGGACCCACTGTCAGGGTGG + Intronic
1137908750 16:52354069-52354091 GTTGGGCCCCACTGACACAGAGG + Intergenic
1142599308 17:1045781-1045803 CCAGGGACCCACTGTCAGATTGG - Intronic
1143474385 17:7194347-7194369 CGTCGGTCTCACTGTCAGAGTGG + Exonic
1143474580 17:7195411-7195433 GGTGGGAGCCAGTGTCTGGGTGG + Intronic
1145007118 17:19344267-19344289 GGTGGGACCCCCTTCCAGGGAGG - Intronic
1145975973 17:28984675-28984697 GGTGCCACCCACTGTCATAGAGG + Intronic
1146467165 17:33095510-33095532 GGTGGGATCCTCTGTCTCAGAGG - Intronic
1146816075 17:35943579-35943601 GGTGGAACCCAGGGTCAGAGAGG - Exonic
1150131936 17:62674197-62674219 AGTGGGGCCACCTGTCAGAGGGG + Intronic
1150178407 17:63087697-63087719 GAGGGGACCCAGTTTCAGAGGGG - Intronic
1151390685 17:73784858-73784880 GGTGGAACCCAGTGTCAGTGTGG - Intergenic
1152375887 17:79918902-79918924 GCTGGGACCCCCTGTCACACAGG + Intergenic
1152542705 17:80984367-80984389 CGTGGATCCCACTGTCAGGGCGG + Intergenic
1152594859 17:81233147-81233169 GGTGAGTCCCACTCTGAGAGGGG - Intronic
1153868688 18:9297011-9297033 GGTGGGCCCCACACTCAGAGCGG + Intergenic
1157340420 18:46772917-46772939 GGTGGGACCGAATGTGGGAGAGG - Intergenic
1158842586 18:61404055-61404077 GGAAGAACACACTGTCAGAGTGG + Intronic
1160501564 18:79403635-79403657 GGTGGCCCCGACTGCCAGAGAGG - Intronic
1160662383 19:307107-307129 GGTGGCACTCACTGTGACAGGGG + Exonic
1160929998 19:1566153-1566175 GGTGGGACCCCCTGGCAGGAGGG - Intronic
1163186458 19:15642343-15642365 GGTGGGAGCCACTGTCATGATGG + Intronic
1167353668 19:48991228-48991250 GGTGGGAGCCACAGACGGAGAGG - Intronic
929906162 2:46048484-46048506 GGTAGGAGGCACTGGCAGAGGGG - Intronic
929951031 2:46409639-46409661 GGTGGAACCAAGTGACAGAGGGG - Intergenic
931089630 2:58871528-58871550 GTTAGGAACCACTGCCAGAGAGG + Intergenic
931794968 2:65700392-65700414 GGTGGGACCCAGTGACCGAGAGG - Intergenic
932289867 2:70567729-70567751 GGCTGGAGCCACTGTCTGAGTGG - Intergenic
932662962 2:73672926-73672948 GGAGGGAGCCACTGTGGGAGCGG + Intergenic
932703707 2:74007590-74007612 AGTGAGACCCACTGACTGAGAGG + Intronic
934940332 2:98496915-98496937 TGTGAAACCCAGTGTCAGAGAGG - Intronic
935583730 2:104782560-104782582 CCTGGGCCCCACTGGCAGAGAGG - Intergenic
936394943 2:112118414-112118436 GGTGGGTCTCACTGTTAGTGAGG + Exonic
937845062 2:126570472-126570494 GGCTGGAGCCACTGTCTGAGTGG - Intergenic
938762748 2:134440343-134440365 GGTCGGGCCCACTGTCTGTGTGG + Intronic
942315333 2:174692322-174692344 AATGGGCCCCACTGTCAGACAGG + Intergenic
944889033 2:204098150-204098172 GCTGGGCCCCACAGTCAGATGGG + Intergenic
945045314 2:205776462-205776484 GGTGGGCTCCACCGCCAGAGGGG - Intronic
945386629 2:209209376-209209398 GGTTGGTCCCACTATCTGAGGGG + Intergenic
948661108 2:239507008-239507030 GGGGAGAGCCACGGTCAGAGCGG + Intergenic
1169814179 20:9639785-9639807 AGTGGGACTGATTGTCAGAGAGG + Intronic
1170386987 20:15830127-15830149 TGTGGGACCCATTGCCACAGTGG + Intronic
1170538933 20:17369038-17369060 GGTGGGCTGCACTGCCAGAGCGG - Intronic
1170683396 20:18547023-18547045 GGTGGGACCCAGTGTGGGGGTGG - Intronic
1172025395 20:31945077-31945099 GCCGGGCCCCACTTTCAGAGGGG + Exonic
1172601061 20:36183267-36183289 GGAGGGACCCAATGGGAGAGAGG - Intronic
1173548151 20:43914813-43914835 GGTGGGAGCCAGTGTGCGAGCGG - Intergenic
1175904115 20:62371446-62371468 GGTGGGCCCCCATGCCAGAGGGG + Intergenic
1176056912 20:63153606-63153628 GGTGGGTCCCACTGGAGGAGGGG + Intergenic
1176685031 21:9839416-9839438 CGTGGGAACCACTGTGACAGGGG + Intergenic
1181026118 22:20128738-20128760 GGTGGGTCCCTGTGGCAGAGTGG + Intergenic
1183343270 22:37293783-37293805 GGAGGCACCCAGTGGCAGAGGGG - Intronic
1184148808 22:42626988-42627010 TGTGGAACCCACTGGTAGAGTGG - Intronic
1184493507 22:44824111-44824133 GCTGAGACCCACTGGCACAGCGG + Intronic
1184666307 22:45990868-45990890 GGCAGGACCCACTGTCTCAGAGG - Intergenic
949289319 3:2445323-2445345 GGTGTGACCCATTATGAGAGAGG - Intronic
949411353 3:3768311-3768333 GATGGGACTGACTGTCAGAGAGG + Intronic
953308582 3:41854166-41854188 GTTGAGAACCACTGCCAGAGAGG + Intronic
953580712 3:44153254-44153276 GGTGGGTCCTACTGTCTCAGAGG + Intergenic
954013152 3:47661352-47661374 GGTGGGATCCACTTTCCCAGAGG + Exonic
955398164 3:58572368-58572390 GGAGGGACCCGCTGTCAGCCAGG + Intronic
956403974 3:68908926-68908948 GGTGGGAAGCGCTGTCAGATGGG - Intronic
961382510 3:126505064-126505086 GGTGGGTCACACGGTGAGAGAGG - Intronic
961747643 3:129075495-129075517 GGTGGGTCACACGGTGAGAGAGG + Intergenic
963554644 3:146772421-146772443 GGTGGGCCCCACACTCAGAGTGG + Intergenic
964376243 3:156051853-156051875 AGTGGGCCCCACAGTCAGAGCGG + Intronic
966372061 3:179261014-179261036 GGTGGGACTTCCTCTCAGAGAGG - Intronic
969306043 4:6326869-6326891 GGCCGGACCAACTGTCAGAGGGG + Intronic
974224269 4:59018553-59018575 GGTGAGACCCAGTGCCACAGTGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
980154715 4:129090672-129090694 TGTGAGACTCACTGGCAGAGTGG - Intronic
980576786 4:134693600-134693622 GCCTGGACCCATTGTCAGAGAGG + Intergenic
984772848 4:183453335-183453357 GTTGGGGACCACTGTCATAGAGG - Intergenic
986104873 5:4650151-4650173 GGTGAGAGCCACTGGCTGAGAGG - Intergenic
986782495 5:11079548-11079570 GTTGGGAGCCAAGGTCAGAGAGG - Intronic
987586471 5:19863168-19863190 GGTGTTACCCAGTGTGAGAGCGG + Intronic
990968158 5:61471829-61471851 GTTGGGGACCACTGTCATAGAGG + Intronic
993619924 5:90156210-90156232 GGAAGGACCAACTGGCAGAGTGG - Intergenic
993879083 5:93342037-93342059 TCTGGCAGCCACTGTCAGAGTGG + Intergenic
994768655 5:103954095-103954117 GGTGGGACCCACACTCTTAGCGG - Intergenic
996847463 5:127915826-127915848 GGTAAGACCCTCTGTCATAGGGG - Intergenic
997699351 5:135885551-135885573 GGAGGGACACAGTGCCAGAGGGG - Intronic
998559202 5:143155349-143155371 GGTGTGACCCATTTTCTGAGTGG + Intronic
1001050282 5:168408533-168408555 AGTGAGACCCCCTGTCAGTGCGG - Exonic
1001952516 5:175826160-175826182 GGTGGGCGCCACTGACTGAGTGG + Intronic
1003834682 6:10058301-10058323 GGTGGGACCCAGGGCCTGAGAGG - Intronic
1005825233 6:29628163-29628185 GGTGGGAGCGACAGTCGGAGGGG + Intronic
1007357911 6:41334266-41334288 GCTGGGCCCCACTGTCGGCGAGG + Intergenic
1007714220 6:43845073-43845095 GCTGGGACCCCCTGCCAGTGAGG + Intergenic
1007944146 6:45810304-45810326 GGTGGGCCACCCTGTCAGGGAGG + Intergenic
1012302465 6:97606422-97606444 GGTGTGACCGACTGTCACTGTGG - Intergenic
1014101847 6:117519880-117519902 TGTGGGATCCACTCTCAAAGCGG - Exonic
1014240720 6:119015400-119015422 GGCGGGCCCCACACTCAGAGCGG + Intronic
1018842354 6:167526504-167526526 GGTGGGATCCACTGTCACAATGG - Intergenic
1020372832 7:7453084-7453106 AGTTGCACCTACTGTCAGAGTGG + Intronic
1021508486 7:21410485-21410507 GATGGGACACACAGGCAGAGTGG + Intergenic
1023533854 7:41187535-41187557 GGTGGGGCCCAGTGTAAGGGAGG - Intergenic
1030836803 7:114297392-114297414 GTTGAGGCCCACTGTCATAGGGG + Intronic
1031056551 7:116998282-116998304 GGCGGGCCCCACACTCAGAGTGG - Intronic
1032641699 7:133776542-133776564 GTTGGGATCCATTGTCAGTGTGG + Intronic
1034258194 7:149735943-149735965 GGTGGGACACAGTTTCAGAGGGG + Intergenic
1035564836 8:634721-634743 CGTGGGACTCAGTGTCACAGCGG - Intronic
1037579130 8:20234403-20234425 GCTGGGACTCTCTGTCACAGGGG + Intergenic
1047216955 8:122883742-122883764 GGTGGAACCAAATGTCAGAAGGG + Intronic
1048302282 8:133260407-133260429 GGTGGGACCCACTGTCAGAGTGG - Intronic
1048874502 8:138826589-138826611 GGTGCCATCCACTGTGAGAGGGG + Intronic
1049315385 8:141964264-141964286 CCTGGGACCCACAGTCAGGGAGG + Intergenic
1049373412 8:142278250-142278272 GCTGGGACCCATGGGCAGAGTGG - Intronic
1049931729 9:463804-463826 AGAGGGTCCCACAGTCAGAGAGG + Intronic
1050334252 9:4575447-4575469 GGTGGCGCCCACTGTCTAAGAGG - Intronic
1051549794 9:18315614-18315636 GGTGGGCCCCGCACTCAGAGCGG - Intergenic
1053159707 9:35805660-35805682 GGTGGGCCTCACTGGCATAGAGG - Exonic
1056013805 9:82360727-82360749 AGTGGGAGCCGCTGTCAGTGTGG + Intergenic
1060024077 9:120156412-120156434 GGTGGGCACCACTGTCTGTGAGG - Intergenic
1060374654 9:123107462-123107484 GGTTGGAACCACAGTCTGAGTGG - Intergenic
1060745997 9:126131293-126131315 GGTGGGACACATTGTGTGAGAGG + Intergenic
1060962860 9:127693483-127693505 GGTGGGCCCAGCTCTCAGAGTGG + Intronic
1061220580 9:129248210-129248232 GGTGGGACCCTCTGTGACACTGG + Intergenic
1061402367 9:130375551-130375573 GGTGGGAGCCACTGTGATGGGGG - Intronic
1187336870 X:18389111-18389133 GGTGTGACCCATTGTCACAAGGG - Intergenic
1194340472 X:92699765-92699787 GGTGGGCCCCACACTCAGAGTGG - Intergenic
1198367082 X:135951684-135951706 GATGGGACCCACTTTAGGAGAGG + Intergenic
1200519723 Y:4195734-4195756 GGCGGGCCCCACACTCAGAGTGG - Intergenic