ID: 1048304471

View in Genome Browser
Species Human (GRCh38)
Location 8:133273989-133274011
Sequence GGCCTAGGTGTCCGGGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048304471_1048304479 6 Left 1048304471 8:133273989-133274011 CCTGCAACCCGGACACCTAGGCC No data
Right 1048304479 8:133274018-133274040 CCGCCCACCCCGTGCCCTGAGGG No data
1048304471_1048304477 5 Left 1048304471 8:133273989-133274011 CCTGCAACCCGGACACCTAGGCC No data
Right 1048304477 8:133274017-133274039 CCCGCCCACCCCGTGCCCTGAGG No data
1048304471_1048304488 24 Left 1048304471 8:133273989-133274011 CCTGCAACCCGGACACCTAGGCC No data
Right 1048304488 8:133274036-133274058 GAGGGTTCTGGAATCTTTTCAGG No data
1048304471_1048304482 12 Left 1048304471 8:133273989-133274011 CCTGCAACCCGGACACCTAGGCC No data
Right 1048304482 8:133274024-133274046 ACCCCGTGCCCTGAGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048304471 Original CRISPR GGCCTAGGTGTCCGGGTTGC AGG (reversed) Intronic