ID: 1048304679

View in Genome Browser
Species Human (GRCh38)
Location 8:133275607-133275629
Sequence GTGAAGGGTGATATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048304679_1048304683 7 Left 1048304679 8:133275607-133275629 CCTGGCTCCATATCACCCTTCAC 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1048304683 8:133275637-133275659 TTCAAAGCACCTACAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048304679 Original CRISPR GTGAAGGGTGATATGGAGCC AGG (reversed) Intronic
900744315 1:4351006-4351028 TTCAAGGGTGATGTGAAGCCTGG + Intergenic
900900907 1:5515229-5515251 GTGGAAGGTAAAATGGAGCCAGG + Intergenic
901008571 1:6184141-6184163 CTGGAGGGTGATAAGGACCCTGG - Intronic
901053318 1:6436890-6436912 GTGGAGGGGGATGTTGAGCCGGG + Intronic
903350885 1:22716011-22716033 CTGAAGGCTGATCTGGTGCCTGG - Intronic
904297270 1:29528108-29528130 GTGAAGTGTATTATGGAGCCAGG - Intergenic
904787773 1:32995560-32995582 GAGATGAGTGATTTGGAGCCAGG - Intergenic
905474651 1:38217630-38217652 GTGGGGGAAGATATGGAGCCAGG + Intergenic
905582218 1:39090872-39090894 CTAAAGTGTTATATGGAGCCTGG + Intronic
906004054 1:42454060-42454082 CTGAAGGATGAAAGGGAGCCAGG + Intronic
908755842 1:67468251-67468273 GGAGAGGGTGGTATGGAGCCAGG - Intergenic
908769407 1:67582765-67582787 GAGAAAGGTGATCTGCAGCCAGG + Intergenic
912535114 1:110362161-110362183 GTGAAAAGTGAAATGGTGCCTGG + Intergenic
912744143 1:112231112-112231134 GCTAAGGGTGAAATGAAGCCAGG + Intergenic
915037843 1:152943605-152943627 CTGAGGGGTGATATGGAACAAGG - Intergenic
916365131 1:164017711-164017733 GTGAAGGCTGACTTGGAACCTGG - Intergenic
916515428 1:165512361-165512383 GTGAAGGGTGAGTTGGAGAGCGG + Intergenic
919766588 1:201131498-201131520 GTGAAGAGTGTTATGGAGGGAGG + Intergenic
920215364 1:204358809-204358831 GGGAAGGGGGCTGTGGAGCCTGG - Intronic
922571049 1:226634904-226634926 GTGAAGGGTGAGCTGAAGCCCGG + Intronic
922951005 1:229558522-229558544 GTGAACGGCGATAGGGACCCGGG + Exonic
924696324 1:246404073-246404095 ATGAAGGGTGATATGCTGGCTGG - Intronic
1066439648 10:35426075-35426097 GTGAAGGGAGAAGAGGAGCCAGG - Intronic
1067940609 10:50651915-50651937 CTGAAGGGTTATATAAAGCCCGG + Intergenic
1070395316 10:76007230-76007252 GGGAAGGGTGACAAGGAGGCGGG - Intronic
1072095409 10:92173657-92173679 GGCCAGGGTGATATGGAGCTAGG - Intronic
1073903722 10:108252188-108252210 GTAAAGGGGGAGATGGAGCAGGG + Intergenic
1076737850 10:132466747-132466769 GTGGAGGGTGTGATGGAGACCGG - Intergenic
1077286423 11:1767973-1767995 GCAAAGGCTGAGATGGAGCCTGG - Intergenic
1077849791 11:6064330-6064352 GTGAAGGGCAATATGGAGATAGG + Intergenic
1078972613 11:16431212-16431234 GTGATGAGTGATATGAAGCATGG - Intronic
1079176472 11:18146331-18146353 GTGAAGGGTAATATGGACATGGG - Intronic
1080622543 11:33998545-33998567 GTGGAGGGGGAGATGGAGTCTGG + Intergenic
1083610732 11:64002993-64003015 GTGAGGGTTGAGCTGGAGCCTGG - Intronic
1083619107 11:64040305-64040327 ATGAAGAGTGAGCTGGAGCCAGG + Intronic
1084172477 11:67407147-67407169 GTGATGGGTGATGTAGCGCCAGG - Intronic
1085531908 11:77196961-77196983 GTCAAGGGAGAACTGGAGCCTGG - Intronic
1087458070 11:98412741-98412763 GTGCAGGGAGATATTAAGCCAGG - Intergenic
1087765335 11:102146139-102146161 TAGAAAGGTGATATGGGGCCAGG - Intronic
1088921530 11:114262773-114262795 CTGACAGGTGATAGGGAGCCAGG - Intronic
1090206024 11:124884937-124884959 GGGAAGGGAGATAAGGAGCAAGG - Intronic
1093075263 12:14751541-14751563 GGGAAGGGAGAAATGGTGCCAGG - Intergenic
1093103280 12:15053967-15053989 CTGAAGGATCATATGTAGCCAGG - Intergenic
1094567356 12:31611733-31611755 GTGAAGAGGGATGTGGAGCGGGG - Intergenic
1094807334 12:34106499-34106521 GTGAAGGGTGGTGTGCATCCAGG + Intergenic
1095813917 12:46400716-46400738 CTGAAGGAGGATGTGGAGCCAGG + Intergenic
1096504172 12:52082270-52082292 GTGTAGAGTGATTTGGTGCCGGG + Intergenic
1097402929 12:59151650-59151672 GTTAAGGGTTATAAGGAGACAGG - Intergenic
1106002646 13:25738559-25738581 GTGAAGGGTGGGAAGGGGCCTGG + Intronic
1106009321 13:25803137-25803159 GTGATGGAGAATATGGAGCCAGG + Intronic
1106124711 13:26890806-26890828 GTGAAGTGTGAAATGGCCCCAGG - Intergenic
1106434271 13:29709928-29709950 GTGAGAGGTGACATTGAGCCAGG - Intergenic
1107359015 13:39599923-39599945 GTGAAGGGAAATAGGAAGCCTGG - Intronic
1108215521 13:48180193-48180215 TTGAAAGATGCTATGGAGCCTGG + Intergenic
1111670906 13:91328923-91328945 GTGAAGGGTAATAGGGAGACTGG + Intergenic
1113047015 13:106167430-106167452 GTGAGTAGTGATATGGAGCAGGG - Intergenic
1113308750 13:109108783-109108805 CTGAAGGGTGAGAAGGAGCTGGG + Intronic
1116405863 14:44565584-44565606 GTGAACGGTGATGTGGAGAAAGG + Intergenic
1116506110 14:45683755-45683777 GTGAAGGGTAATGGGGAGACAGG - Intergenic
1121108084 14:91293668-91293690 GTGAAGGGTTACATGAAGCATGG - Intronic
1121781767 14:96626586-96626608 CTGGAGGGTGACGTGGAGCCAGG + Intergenic
1123735559 15:23179950-23179972 GTGAAGGGCGATATGGACTGGGG - Intergenic
1124286275 15:28402933-28402955 GTGAAGGGCGATATGGACTGGGG - Intergenic
1124296428 15:28508703-28508725 GTGAAGGGCGATATGGACTGGGG + Intergenic
1126773127 15:52077316-52077338 GTGAATGGTGAGAAGGAACCAGG + Intergenic
1127328314 15:57916373-57916395 GTGAAGGCTGATGTGGGACCTGG + Intergenic
1128242709 15:66111956-66111978 GTAAAGGGTGATCTTGAACCGGG + Intronic
1128560882 15:68667065-68667087 GTGAAGGGAGATCAGGAGCGGGG - Intronic
1133754384 16:8751585-8751607 GTGAAGGGTCATAAAAAGCCAGG - Intronic
1137477686 16:48824695-48824717 GTGGAGTTTGATATGGAGCATGG - Intergenic
1138347922 16:56331322-56331344 GTGAAAGGTGCTCTGGGGCCTGG + Intronic
1138483248 16:57318200-57318222 CTGAAGGGTGGTATGGAGAAAGG + Intergenic
1144590597 17:16520603-16520625 GTGCAGGTTGATAGGGAGGCTGG + Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1144835132 17:18152830-18152852 ATGAATGGTGAGAAGGAGCCAGG - Intronic
1145241257 17:21242097-21242119 CTGGAGGGTGACCTGGAGCCAGG - Exonic
1146890638 17:36504282-36504304 GGGCAGGGTGAGACGGAGCCAGG - Intronic
1151904825 17:77040839-77040861 CTGACAGGTGATAGGGAGCCTGG - Intergenic
1152377525 17:79926531-79926553 GAGGTGGGGGATATGGAGCCGGG - Intergenic
1155972442 18:32093886-32093908 GTTAAGTTTGAAATGGAGCCTGG - Intronic
1156447615 18:37249033-37249055 GTGAAGGTTGAGCTGGAGGCCGG - Intronic
1157751584 18:50183565-50183587 GTTAAGTGAGAGATGGAGCCAGG + Intronic
1160189998 18:76708077-76708099 GAGAAGGATGATCTGGAGTCAGG - Intergenic
1163121355 19:15220101-15220123 GAGAAGGGAGAGGTGGAGCCAGG - Intergenic
1163359558 19:16837212-16837234 GAGAAGGGGGAGAGGGAGCCAGG + Intronic
1163429097 19:17256335-17256357 GTGAAGGGAGAATTGGAGCTGGG - Intronic
1165806906 19:38585985-38586007 GTGAAGGAGGATATGGAGGTAGG + Exonic
1166939600 19:46354809-46354831 AAGAAGGGTGATATGCTGCCAGG + Intronic
1167259440 19:48450273-48450295 GGGAAGGGTGATGTGAAGCGAGG - Intronic
1168586777 19:57600192-57600214 GTGAAGGGTTTTCTGCAGCCCGG + Intronic
925675976 2:6361165-6361187 GTCAAGGGTGAGAAGGAGCCAGG + Intergenic
925971939 2:9112186-9112208 GTGGAGGGTGAGATGGCTCCAGG - Intergenic
926701832 2:15809196-15809218 GGGGAGGGTGATCTGGGGCCTGG + Intergenic
927084439 2:19660460-19660482 GTGGAGGGTGAAGGGGAGCCAGG - Intergenic
932571161 2:72939081-72939103 GTGAAGGGAGACATGGACCAAGG - Intergenic
933019557 2:77174088-77174110 GGATGGGGTGATATGGAGCCAGG - Intronic
933748627 2:85588828-85588850 TTGAAGGATGACATGGAGCAGGG - Intronic
935332560 2:101987814-101987836 GGGAAGGGTGATGTGGAGGATGG + Intergenic
936708227 2:115101135-115101157 GTGATGGATGACATGGAGTCTGG + Intronic
937866261 2:126753626-126753648 CTGAGGGGCGTTATGGAGCCTGG - Intergenic
938250631 2:129813045-129813067 GTGAATGGGGATAAGGAGTCTGG - Intergenic
938552295 2:132393493-132393515 GTGGAAGGTGATCAGGAGCCAGG - Intergenic
939429847 2:142089153-142089175 TTGAAGGGACATATGGAGCCAGG + Intronic
939994250 2:148905683-148905705 GAGAAGGGAGAGATGGAGCCAGG + Intronic
940961664 2:159793776-159793798 GGGAAGAGTGATATGGAGAGGGG - Intronic
943740959 2:191408542-191408564 GAGAGGGGTGACAGGGAGCCAGG + Intronic
944138779 2:196432094-196432116 GGGTAGGGGGATATGAAGCCAGG - Intronic
946326419 2:218986758-218986780 GTGGAGGGTGCAAAGGAGCCAGG + Intergenic
947705788 2:232274354-232274376 GTGGAGTGTGACATGGAGGCAGG - Intronic
948932575 2:241141563-241141585 GGAATGGGTGAGATGGAGCCAGG - Intronic
1169989228 20:11482058-11482080 CTGAAAGGTAAGATGGAGCCAGG + Intergenic
1172626207 20:36348803-36348825 ATAAAGAGTGATATGGGGCCAGG + Intronic
1172842864 20:37912550-37912572 GTGCAGGCTGAGAGGGAGCCTGG + Intronic
1173044016 20:39492214-39492236 GTGAAGGGTCAGATGGAACCTGG + Intergenic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1175761453 20:61564543-61564565 GTGGAGGGTGAAGCGGAGCCAGG - Intronic
1176114934 20:63428113-63428135 GCGAAGGTTGATATGGGGCCGGG - Intronic
1178063570 21:28878237-28878259 GTGAAAGGAGATCTGGAACCAGG + Exonic
1180801216 22:18632832-18632854 GTGAAGGGTGCTGTGGAGGAGGG + Intergenic
1180852445 22:19028389-19028411 GTGAAGGGTGCTGTGGAGGAGGG + Intergenic
1181220505 22:21362429-21362451 GTGAAGGGTGCTGTGGAGGAGGG - Intergenic
1181618420 22:24071049-24071071 GGGCAGGGTGAGAAGGAGCCAGG - Intronic
1184117944 22:42432828-42432850 GTGAGGGGTGGTAGGGAGGCTGG + Intergenic
1184445105 22:44542511-44542533 GTGTATGGGGAGATGGAGCCTGG + Intergenic
950421509 3:12902378-12902400 GTGGAGGGTGAGTGGGAGCCGGG + Intronic
950464138 3:13143329-13143351 GGGATGGGTGAAATGGGGCCTGG + Intergenic
950880793 3:16321310-16321332 GTGAAGGGAGAAATGGGGCTGGG + Intronic
951795969 3:26538752-26538774 GGGAAGGGTTATAGGGAGCTGGG - Intergenic
953398433 3:42591070-42591092 GTGAAGGGTGCTGAGCAGCCGGG + Intronic
954257736 3:49418093-49418115 GTGAAGGGAGGAATAGAGCCTGG - Intronic
954886808 3:53882067-53882089 GAGAAGGGTGATACGGAGAACGG - Exonic
958838099 3:99170925-99170947 CTCAAGGGTGGCATGGAGCCAGG + Intergenic
959072816 3:101718858-101718880 GGGAAGGGTGAAATGGAAACAGG - Intergenic
960312143 3:116129909-116129931 CTGGAGGGTGATTTGGAGACTGG + Intronic
960914023 3:122679468-122679490 GTGAAGGGGAAGAAGGAGCCAGG - Intergenic
964405098 3:156340496-156340518 GTGTAGGGTGAGATGGAACCAGG - Intronic
965778396 3:172257659-172257681 GTGGAGGGTGACAAGGACCCAGG - Intronic
966217089 3:177515043-177515065 GTCAAAGGTGAAATGCAGCCTGG + Intergenic
967493193 3:190116619-190116641 GGGAAGGTTGAGAGGGAGCCAGG + Intronic
968225626 3:196970159-196970181 GTGAGGGGTGCTATGGGGCACGG - Intergenic
968803865 4:2760078-2760100 CTAAAGGGTGAGAAGGAGCCAGG + Intergenic
968819073 4:2836596-2836618 GTGAGGGGTGGCAGGGAGCCTGG - Exonic
969045232 4:4331739-4331761 GTGCAGGATGAGATGAAGCCAGG + Intergenic
969878476 4:10153865-10153887 GTGAAAGCTGATATGGGACCTGG + Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
976411017 4:84713689-84713711 TTGAAGGGTGATACAGATCCTGG - Intronic
977134500 4:93286466-93286488 AGGAAGGGTGATATGAACCCTGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
986424007 5:7612652-7612674 GTGAAGGGTGAGAAGGAGAGTGG + Intronic
988925842 5:35990660-35990682 GTGAAGCTGCATATGGAGCCAGG - Intronic
991297893 5:65101060-65101082 GTGAAGAGTGATATGGACACAGG + Intergenic
997206929 5:132055683-132055705 CTAAAGGATGATCTGGAGCCAGG - Intergenic
999150708 5:149424260-149424282 GTGAAAGGTGATGTTGAACCAGG - Intergenic
999473232 5:151874762-151874784 CTGAAGGGTGAGAAGGAGCCAGG + Intronic
1000213243 5:159129827-159129849 CTGAAGGGTGAAATAGAGTCAGG + Intergenic
1002189453 5:177471165-177471187 GTGGAGGGTGAGCTGGAGTCGGG + Intronic
1002858286 6:1057186-1057208 GTGAAGGGTCATTTGAGGCCAGG - Intergenic
1012720523 6:102736750-102736772 GAGAAGGGGGATAAGGAGCTTGG + Intergenic
1012782748 6:103583560-103583582 GGAAAGAGTGATATGGAGCTGGG - Intergenic
1019227874 6:170530022-170530044 TTGGAGGGTGATGTGGAGCCTGG + Intergenic
1024984201 7:55181501-55181523 GGGAGGGGAGATAAGGAGCCAGG + Intronic
1027517761 7:79163952-79163974 GTAAGGGGTGAGATGGAGTCAGG - Intronic
1028463813 7:91126323-91126345 GTGGAGGTTGGTATGGCGCCAGG - Intronic
1028898843 7:96073247-96073269 GTGAAGGGTGATAAGGAGGTTGG + Intronic
1029192859 7:98784148-98784170 GTGAATGTTGAAATGGAGACAGG - Intergenic
1032409744 7:131686268-131686290 GGGAATGGTGACAGGGAGCCAGG + Intergenic
1039063762 8:33592273-33592295 GGAAAGGGTGACATGGGGCCGGG + Intronic
1041157810 8:55005906-55005928 GTGAAGGTGGATGTGAAGCCAGG - Intergenic
1042676412 8:71326826-71326848 GTGAATGGTGACATGGAAACAGG - Intronic
1044426967 8:92063023-92063045 GTGAGGGGTGGTAGGGGGCCAGG - Intronic
1044604514 8:94036990-94037012 CAGAAGGGTGATATGTTGCCAGG - Intergenic
1045509783 8:102805783-102805805 AGGAAGGGTGACGTGGAGCCAGG - Intergenic
1048304679 8:133275607-133275629 GTGAAGGGTGATATGGAGCCAGG - Intronic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1049762410 8:144337278-144337300 GTGTGGGGAGAAATGGAGCCAGG + Intergenic
1056833755 9:89937219-89937241 GTGAAGGGTGTTTGGCAGCCAGG + Intergenic
1057286992 9:93764653-93764675 GTGAGGGCTGGCATGGAGCCTGG - Intergenic
1060483052 9:124029225-124029247 CTGGAGGGTGGCATGGAGCCTGG + Intronic
1061203001 9:129148048-129148070 GGGCAGGGTGAAAAGGAGCCTGG - Exonic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1062141669 9:134962537-134962559 GTTAAGGGGCATGTGGAGCCAGG - Intergenic
1185734405 X:2486028-2486050 GAGAGGGGTGATAAGGAGGCTGG + Intronic
1186465198 X:9779397-9779419 GAAAAGGGTGATAGTGAGCCAGG - Intronic
1187394057 X:18905060-18905082 GTGGAGGGTGATGTGAGGCCGGG + Intronic
1191831479 X:65420228-65420250 GTGAGGGGTGGTATGAAGCCTGG - Intronic
1192092298 X:68172864-68172886 GTCAAGGATAATATGGAGCCTGG - Intronic
1192714744 X:73627676-73627698 CTGAAGGGTGATTTGAAGGCTGG - Intronic
1195423121 X:104697659-104697681 GTCTAGGGTGAGATGCAGCCAGG + Intronic
1196441201 X:115721563-115721585 GTGAGGAGTGAAATGGAGCCAGG + Intergenic
1196444729 X:115839551-115839573 GTGAGGAGTGAAATGGAGCCAGG + Intergenic
1202124790 Y:21557891-21557913 GAGAAGCCTGACATGGAGCCTGG - Intergenic
1202154218 Y:21871489-21871511 GAGAAGCCTGACATGGAGCCTGG + Intergenic