ID: 1048306281

View in Genome Browser
Species Human (GRCh38)
Location 8:133286975-133286997
Sequence GCTGCTGGCGGTCCACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048306272_1048306281 28 Left 1048306272 8:133286924-133286946 CCGCATGAACCAAGGACTGCAGA 0: 1
1: 0
2: 2
3: 12
4: 197
Right 1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG No data
1048306274_1048306281 19 Left 1048306274 8:133286933-133286955 CCAAGGACTGCAGAAGGTGCTCT 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1048306281 8:133286975-133286997 GCTGCTGGCGGTCCACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048306281 Original CRISPR GCTGCTGGCGGTCCACCATC TGG Intronic
No off target data available for this crispr