ID: 1048307430

View in Genome Browser
Species Human (GRCh38)
Location 8:133294148-133294170
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307430_1048307436 25 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data
1048307430_1048307437 26 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307430_1048307431 -10 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307431 8:133294161-133294183 GGCGCCCCAACATGTTGTCATGG No data
1048307430_1048307435 4 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307435 8:133294175-133294197 TTGTCATGGAAAAAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307430 Original CRISPR TTGGGGCGCCTGAAGAAATC AGG (reversed) Intronic