ID: 1048307430 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:133294148-133294170 |
| Sequence | TTGGGGCGCCTGAAGAAATC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048307430_1048307431 | -10 | Left | 1048307430 | 8:133294148-133294170 | CCTGATTTCTTCAGGCGCCCCAA | No data | ||
| Right | 1048307431 | 8:133294161-133294183 | GGCGCCCCAACATGTTGTCATGG | No data | ||||
| 1048307430_1048307437 | 26 | Left | 1048307430 | 8:133294148-133294170 | CCTGATTTCTTCAGGCGCCCCAA | No data | ||
| Right | 1048307437 | 8:133294197-133294219 | GCTCTGAAGTCCAACTGTCCGGG | No data | ||||
| 1048307430_1048307435 | 4 | Left | 1048307430 | 8:133294148-133294170 | CCTGATTTCTTCAGGCGCCCCAA | No data | ||
| Right | 1048307435 | 8:133294175-133294197 | TTGTCATGGAAAAAAAACAAAGG | 0: 1 1: 0 2: 8 3: 63 4: 763 |
||||
| 1048307430_1048307436 | 25 | Left | 1048307430 | 8:133294148-133294170 | CCTGATTTCTTCAGGCGCCCCAA | No data | ||
| Right | 1048307436 | 8:133294196-133294218 | GGCTCTGAAGTCCAACTGTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048307430 | Original CRISPR | TTGGGGCGCCTGAAGAAATC AGG (reversed) | Intronic | ||