ID: 1048307431

View in Genome Browser
Species Human (GRCh38)
Location 8:133294161-133294183
Sequence GGCGCCCCAACATGTTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307428_1048307431 4 Left 1048307428 8:133294134-133294156 CCTTTTCATTTGAGCCTGATTTC No data
Right 1048307431 8:133294161-133294183 GGCGCCCCAACATGTTGTCATGG No data
1048307430_1048307431 -10 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307431 8:133294161-133294183 GGCGCCCCAACATGTTGTCATGG No data
1048307427_1048307431 12 Left 1048307427 8:133294126-133294148 CCTGACTGCCTTTTCATTTGAGC No data
Right 1048307431 8:133294161-133294183 GGCGCCCCAACATGTTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307431 Original CRISPR GGCGCCCCAACATGTTGTCA TGG Intronic