ID: 1048307431 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:133294161-133294183 |
| Sequence | GGCGCCCCAACATGTTGTCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048307428_1048307431 | 4 | Left | 1048307428 | 8:133294134-133294156 | CCTTTTCATTTGAGCCTGATTTC | No data | ||
| Right | 1048307431 | 8:133294161-133294183 | GGCGCCCCAACATGTTGTCATGG | No data | ||||
| 1048307430_1048307431 | -10 | Left | 1048307430 | 8:133294148-133294170 | CCTGATTTCTTCAGGCGCCCCAA | No data | ||
| Right | 1048307431 | 8:133294161-133294183 | GGCGCCCCAACATGTTGTCATGG | No data | ||||
| 1048307427_1048307431 | 12 | Left | 1048307427 | 8:133294126-133294148 | CCTGACTGCCTTTTCATTTGAGC | No data | ||
| Right | 1048307431 | 8:133294161-133294183 | GGCGCCCCAACATGTTGTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048307431 | Original CRISPR | GGCGCCCCAACATGTTGTCA TGG | Intronic | ||