ID: 1048307433

View in Genome Browser
Species Human (GRCh38)
Location 8:133294166-133294188
Sequence TTTTTCCATGACAACATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307433_1048307437 8 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA No data
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307433_1048307436 7 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data
1048307433_1048307439 20 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA No data
Right 1048307439 8:133294209-133294231 AACTGTCCGGGTTCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307433 Original CRISPR TTTTTCCATGACAACATGTT GGG (reversed) Intronic