ID: 1048307434

View in Genome Browser
Species Human (GRCh38)
Location 8:133294167-133294189
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307434_1048307439 19 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA No data
Right 1048307439 8:133294209-133294231 AACTGTCCGGGTTCAAAGTCTGG No data
1048307434_1048307437 7 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA No data
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307434_1048307436 6 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307434 Original CRISPR TTTTTTCCATGACAACATGT TGG (reversed) Intronic