ID: 1048307435

View in Genome Browser
Species Human (GRCh38)
Location 8:133294175-133294197
Sequence TTGTCATGGAAAAAAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307430_1048307435 4 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307435 8:133294175-133294197 TTGTCATGGAAAAAAAACAAAGG No data
1048307428_1048307435 18 Left 1048307428 8:133294134-133294156 CCTTTTCATTTGAGCCTGATTTC No data
Right 1048307435 8:133294175-133294197 TTGTCATGGAAAAAAAACAAAGG No data
1048307427_1048307435 26 Left 1048307427 8:133294126-133294148 CCTGACTGCCTTTTCATTTGAGC No data
Right 1048307435 8:133294175-133294197 TTGTCATGGAAAAAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307435 Original CRISPR TTGTCATGGAAAAAAAACAA AGG Intronic