ID: 1048307436

View in Genome Browser
Species Human (GRCh38)
Location 8:133294196-133294218
Sequence GGCTCTGAAGTCCAACTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307433_1048307436 7 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data
1048307434_1048307436 6 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data
1048307432_1048307436 8 Left 1048307432 8:133294165-133294187 CCCCAACATGTTGTCATGGAAAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data
1048307430_1048307436 25 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA No data
Right 1048307436 8:133294196-133294218 GGCTCTGAAGTCCAACTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307436 Original CRISPR GGCTCTGAAGTCCAACTGTC CGG Intronic