ID: 1048307437

View in Genome Browser
Species Human (GRCh38)
Location 8:133294197-133294219
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307434_1048307437 7 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA 0: 1
1: 0
2: 0
3: 23
4: 350
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307433_1048307437 8 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA 0: 1
1: 0
2: 1
3: 22
4: 283
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307432_1048307437 9 Left 1048307432 8:133294165-133294187 CCCCAACATGTTGTCATGGAAAA 0: 1
1: 0
2: 0
3: 20
4: 230
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data
1048307430_1048307437 26 Left 1048307430 8:133294148-133294170 CCTGATTTCTTCAGGCGCCCCAA 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1048307437 8:133294197-133294219 GCTCTGAAGTCCAACTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr