ID: 1048307439

View in Genome Browser
Species Human (GRCh38)
Location 8:133294209-133294231
Sequence AACTGTCCGGGTTCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048307432_1048307439 21 Left 1048307432 8:133294165-133294187 CCCCAACATGTTGTCATGGAAAA No data
Right 1048307439 8:133294209-133294231 AACTGTCCGGGTTCAAAGTCTGG No data
1048307433_1048307439 20 Left 1048307433 8:133294166-133294188 CCCAACATGTTGTCATGGAAAAA No data
Right 1048307439 8:133294209-133294231 AACTGTCCGGGTTCAAAGTCTGG No data
1048307434_1048307439 19 Left 1048307434 8:133294167-133294189 CCAACATGTTGTCATGGAAAAAA No data
Right 1048307439 8:133294209-133294231 AACTGTCCGGGTTCAAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048307439 Original CRISPR AACTGTCCGGGTTCAAAGTC TGG Intronic