ID: 1048315138

View in Genome Browser
Species Human (GRCh38)
Location 8:133356195-133356217
Sequence GAAAATGAGGAGTGCAGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315138_1048315146 14 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315146 8:133356232-133356254 GTCCCGGGAGGCTGTGGCTCTGG No data
1048315138_1048315144 8 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315144 8:133356226-133356248 CTGCCTGTCCCGGGAGGCTGTGG No data
1048315138_1048315149 19 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315149 8:133356237-133356259 GGGAGGCTGTGGCTCTGGACTGG No data
1048315138_1048315150 23 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315150 8:133356241-133356263 GGCTGTGGCTCTGGACTGGAAGG No data
1048315138_1048315142 -1 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315142 8:133356217-133356239 CATGGTCTGCTGCCTGTCCCGGG No data
1048315138_1048315151 24 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315151 8:133356242-133356264 GCTGTGGCTCTGGACTGGAAGGG No data
1048315138_1048315143 2 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315143 8:133356220-133356242 GGTCTGCTGCCTGTCCCGGGAGG No data
1048315138_1048315152 28 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data
1048315138_1048315141 -2 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315141 8:133356216-133356238 TCATGGTCTGCTGCCTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315138 Original CRISPR GAAAATGAGGAGTGCAGCCG TGG (reversed) Intergenic
No off target data available for this crispr