ID: 1048315140

View in Genome Browser
Species Human (GRCh38)
Location 8:133356208-133356230
Sequence GGCAGCAGACCATGAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315140_1048315146 1 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315146 8:133356232-133356254 GTCCCGGGAGGCTGTGGCTCTGG No data
1048315140_1048315150 10 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315150 8:133356241-133356263 GGCTGTGGCTCTGGACTGGAAGG No data
1048315140_1048315152 15 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data
1048315140_1048315149 6 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315149 8:133356237-133356259 GGGAGGCTGTGGCTCTGGACTGG No data
1048315140_1048315151 11 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315151 8:133356242-133356264 GCTGTGGCTCTGGACTGGAAGGG No data
1048315140_1048315153 18 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data
1048315140_1048315144 -5 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315144 8:133356226-133356248 CTGCCTGTCCCGGGAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315140 Original CRISPR GGCAGCAGACCATGAAAATG AGG (reversed) Intergenic
No off target data available for this crispr