ID: 1048315145

View in Genome Browser
Species Human (GRCh38)
Location 8:133356229-133356251
Sequence GAGCCACAGCCTCCCGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315145_1048315153 -3 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data
1048315145_1048315154 11 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315154 8:133356263-133356285 GGCTGGAGGTCCCCTCCCTGAGG No data
1048315145_1048315151 -10 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315151 8:133356242-133356264 GCTGTGGCTCTGGACTGGAAGGG No data
1048315145_1048315152 -6 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315145 Original CRISPR GAGCCACAGCCTCCCGGGAC AGG (reversed) Intergenic
No off target data available for this crispr