ID: 1048315152

View in Genome Browser
Species Human (GRCh38)
Location 8:133356246-133356268
Sequence TGGCTCTGGACTGGAAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315145_1048315152 -6 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data
1048315138_1048315152 28 Left 1048315138 8:133356195-133356217 CCACGGCTGCACTCCTCATTTTC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data
1048315140_1048315152 15 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315152 8:133356246-133356268 TGGCTCTGGACTGGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315152 Original CRISPR TGGCTCTGGACTGGAAGGGC TGG Intergenic
No off target data available for this crispr