ID: 1048315153

View in Genome Browser
Species Human (GRCh38)
Location 8:133356249-133356271
Sequence CTCTGGACTGGAAGGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315147_1048315153 -8 Left 1048315147 8:133356234-133356256 CCCGGGAGGCTGTGGCTCTGGAC No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data
1048315140_1048315153 18 Left 1048315140 8:133356208-133356230 CCTCATTTTCATGGTCTGCTGCC No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data
1048315148_1048315153 -9 Left 1048315148 8:133356235-133356257 CCGGGAGGCTGTGGCTCTGGACT No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data
1048315145_1048315153 -3 Left 1048315145 8:133356229-133356251 CCTGTCCCGGGAGGCTGTGGCTC No data
Right 1048315153 8:133356249-133356271 CTCTGGACTGGAAGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315153 Original CRISPR CTCTGGACTGGAAGGGCTGG AGG Intergenic
No off target data available for this crispr