ID: 1048315501

View in Genome Browser
Species Human (GRCh38)
Location 8:133358920-133358942
Sequence AGGAACTGCACAGTGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048315497_1048315501 -4 Left 1048315497 8:133358901-133358923 CCTAGCAGTGTCCCTGGCAAGGA No data
Right 1048315501 8:133358920-133358942 AGGAACTGCACAGTGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048315501 Original CRISPR AGGAACTGCACAGTGGATAC TGG Intergenic
No off target data available for this crispr