ID: 1048319773

View in Genome Browser
Species Human (GRCh38)
Location 8:133389325-133389347
Sequence CTGGCTTGTGGGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048319773_1048319779 -1 Left 1048319773 8:133389325-133389347 CCCTGCTGCCTCCCACAAGCCAG No data
Right 1048319779 8:133389347-133389369 GTCTCTAGCCAATTCTTCTGTGG No data
1048319773_1048319780 5 Left 1048319773 8:133389325-133389347 CCCTGCTGCCTCCCACAAGCCAG No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319773_1048319781 6 Left 1048319773 8:133389325-133389347 CCCTGCTGCCTCCCACAAGCCAG No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048319773 Original CRISPR CTGGCTTGTGGGAGGCAGCA GGG (reversed) Intergenic
No off target data available for this crispr