ID: 1048319780

View in Genome Browser
Species Human (GRCh38)
Location 8:133389353-133389375
Sequence AGCCAATTCTTCTGTGGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048319777_1048319780 -7 Left 1048319777 8:133389337-133389359 CCACAAGCCAGTCTCTAGCCAAT No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319775_1048319780 -3 Left 1048319775 8:133389333-133389355 CCTCCCACAAGCCAGTCTCTAGC No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319776_1048319780 -6 Left 1048319776 8:133389336-133389358 CCCACAAGCCAGTCTCTAGCCAA No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319772_1048319780 9 Left 1048319772 8:133389321-133389343 CCTTCCCTGCTGCCTCCCACAAG No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319773_1048319780 5 Left 1048319773 8:133389325-133389347 CCCTGCTGCCTCCCACAAGCCAG No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319771_1048319780 12 Left 1048319771 8:133389318-133389340 CCTCCTTCCCTGCTGCCTCCCAC No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319774_1048319780 4 Left 1048319774 8:133389326-133389348 CCTGCTGCCTCCCACAAGCCAGT No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data
1048319770_1048319780 13 Left 1048319770 8:133389317-133389339 CCCTCCTTCCCTGCTGCCTCCCA No data
Right 1048319780 8:133389353-133389375 AGCCAATTCTTCTGTGGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048319780 Original CRISPR AGCCAATTCTTCTGTGGTTA AGG Intergenic
No off target data available for this crispr