ID: 1048319781

View in Genome Browser
Species Human (GRCh38)
Location 8:133389354-133389376
Sequence GCCAATTCTTCTGTGGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048319776_1048319781 -5 Left 1048319776 8:133389336-133389358 CCCACAAGCCAGTCTCTAGCCAA No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319771_1048319781 13 Left 1048319771 8:133389318-133389340 CCTCCTTCCCTGCTGCCTCCCAC No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319775_1048319781 -2 Left 1048319775 8:133389333-133389355 CCTCCCACAAGCCAGTCTCTAGC No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319774_1048319781 5 Left 1048319774 8:133389326-133389348 CCTGCTGCCTCCCACAAGCCAGT No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319772_1048319781 10 Left 1048319772 8:133389321-133389343 CCTTCCCTGCTGCCTCCCACAAG No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319773_1048319781 6 Left 1048319773 8:133389325-133389347 CCCTGCTGCCTCCCACAAGCCAG No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319777_1048319781 -6 Left 1048319777 8:133389337-133389359 CCACAAGCCAGTCTCTAGCCAAT No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data
1048319770_1048319781 14 Left 1048319770 8:133389317-133389339 CCCTCCTTCCCTGCTGCCTCCCA No data
Right 1048319781 8:133389354-133389376 GCCAATTCTTCTGTGGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048319781 Original CRISPR GCCAATTCTTCTGTGGTTAA GGG Intergenic
No off target data available for this crispr