ID: 1048319800

View in Genome Browser
Species Human (GRCh38)
Location 8:133389589-133389611
Sequence CGACCCAAGGTCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048319795_1048319800 17 Left 1048319795 8:133389549-133389571 CCTTTTGACAGATGATGAAATAT No data
Right 1048319800 8:133389589-133389611 CGACCCAAGGTCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048319800 Original CRISPR CGACCCAAGGTCCCACAGGC AGG Intergenic
No off target data available for this crispr