ID: 1048324638

View in Genome Browser
Species Human (GRCh38)
Location 8:133429546-133429568
Sequence CTCAGCTGCCACCACTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048324635_1048324638 -6 Left 1048324635 8:133429529-133429551 CCCACTGGACTCAGGGCCTCAGC No data
Right 1048324638 8:133429546-133429568 CTCAGCTGCCACCACTGCTCTGG No data
1048324636_1048324638 -7 Left 1048324636 8:133429530-133429552 CCACTGGACTCAGGGCCTCAGCT No data
Right 1048324638 8:133429546-133429568 CTCAGCTGCCACCACTGCTCTGG No data
1048324631_1048324638 30 Left 1048324631 8:133429493-133429515 CCTCAGGGACATCTGGGGGGCTT No data
Right 1048324638 8:133429546-133429568 CTCAGCTGCCACCACTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048324638 Original CRISPR CTCAGCTGCCACCACTGCTC TGG Intergenic
No off target data available for this crispr