ID: 1048326513

View in Genome Browser
Species Human (GRCh38)
Location 8:133443238-133443260
Sequence CTATGCTGCTGGAAGACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048326510_1048326513 4 Left 1048326510 8:133443211-133443233 CCATCTTCTGCTTCTGCTGGGGT No data
Right 1048326513 8:133443238-133443260 CTATGCTGCTGGAAGACACCTGG No data
1048326506_1048326513 7 Left 1048326506 8:133443208-133443230 CCTCCATCTTCTGCTTCTGCTGG No data
Right 1048326513 8:133443238-133443260 CTATGCTGCTGGAAGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048326513 Original CRISPR CTATGCTGCTGGAAGACACC TGG Intergenic
No off target data available for this crispr