ID: 1048326976

View in Genome Browser
Species Human (GRCh38)
Location 8:133447366-133447388
Sequence CCGTCCCTACGACCTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048326971_1048326976 1 Left 1048326971 8:133447342-133447364 CCTCTGGAGCAAAGCTGAAATTC No data
Right 1048326976 8:133447366-133447388 CCGTCCCTACGACCTTGAGGGGG No data
1048326967_1048326976 29 Left 1048326967 8:133447314-133447336 CCAGCTGACAGGGGCCACCACTG No data
Right 1048326976 8:133447366-133447388 CCGTCCCTACGACCTTGAGGGGG No data
1048326970_1048326976 12 Left 1048326970 8:133447331-133447353 CCACTGTAGTGCCTCTGGAGCAA No data
Right 1048326976 8:133447366-133447388 CCGTCCCTACGACCTTGAGGGGG No data
1048326969_1048326976 15 Left 1048326969 8:133447328-133447350 CCACCACTGTAGTGCCTCTGGAG No data
Right 1048326976 8:133447366-133447388 CCGTCCCTACGACCTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048326976 Original CRISPR CCGTCCCTACGACCTTGAGG GGG Intergenic
No off target data available for this crispr