ID: 1048327576

View in Genome Browser
Species Human (GRCh38)
Location 8:133451132-133451154
Sequence GAGTTGAATGAGATGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048327576_1048327586 28 Left 1048327576 8:133451132-133451154 CCTTGGACCATCTCATTCAACTC No data
Right 1048327586 8:133451183-133451205 TCGTGATCTATAGCCTGATGAGG No data
1048327576_1048327582 3 Left 1048327576 8:133451132-133451154 CCTTGGACCATCTCATTCAACTC No data
Right 1048327582 8:133451158-133451180 GCAGGCCACATGCAGACCCAGGG No data
1048327576_1048327581 2 Left 1048327576 8:133451132-133451154 CCTTGGACCATCTCATTCAACTC No data
Right 1048327581 8:133451157-133451179 TGCAGGCCACATGCAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048327576 Original CRISPR GAGTTGAATGAGATGGTCCA AGG (reversed) Intergenic
No off target data available for this crispr