ID: 1048330944

View in Genome Browser
Species Human (GRCh38)
Location 8:133470570-133470592
Sequence AGCTCAGGCCACCAGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 269}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048330944_1048330951 -7 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG No data
1048330944_1048330958 23 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330958 8:133470616-133470638 GTCAGCTTCCCTGGAAGCAGAGG No data
1048330944_1048330956 14 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330956 8:133470607-133470629 GGGCCTCGGGTCAGCTTCCCTGG No data
1048330944_1048330952 -6 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330952 8:133470587-133470609 TGAGCTCCTTGGGAAGCACGGGG No data
1048330944_1048330961 29 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330961 8:133470622-133470644 TTCCCTGGAAGCAGAGGCTGGGG No data
1048330944_1048330959 27 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330959 8:133470620-133470642 GCTTCCCTGGAAGCAGAGGCTGG No data
1048330944_1048330960 28 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330960 8:133470621-133470643 CTTCCCTGGAAGCAGAGGCTGGG No data
1048330944_1048330955 1 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330955 8:133470594-133470616 CTTGGGAAGCACGGGGCCTCGGG No data
1048330944_1048330950 -8 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330950 8:133470585-133470607 CCTGAGCTCCTTGGGAAGCACGG No data
1048330944_1048330954 0 Left 1048330944 8:133470570-133470592 CCTGCCGCCTGGTGGCCTGAGCT 0: 1
1: 0
2: 2
3: 28
4: 269
Right 1048330954 8:133470593-133470615 CCTTGGGAAGCACGGGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048330944 Original CRISPR AGCTCAGGCCACCAGGCGGC AGG (reversed) Intronic
900014201 1:137489-137511 TGTACAGGCCACCAGGAGGCAGG + Intergenic
900044064 1:492691-492713 TGTACAGGCCACCAGGAGGCAGG + Intergenic
900065474 1:727597-727619 TGTACAGGCCACCAGGAGGCAGG + Intergenic
900104095 1:974851-974873 AGCTCAGCCCGCCAGGAGTCAGG + Exonic
900597872 1:3490693-3490715 AGCTCAGCCCAGCAGGTGGGTGG + Intronic
900602829 1:3510318-3510340 AGCACAGCCCTCCAGGCAGCAGG + Intronic
900948419 1:5844161-5844183 GGCTCAGGCCAGCAGATGGCAGG - Intergenic
901600425 1:10419410-10419432 TGCTCAGGACTCCTGGCGGCGGG + Exonic
901684306 1:10935151-10935173 AGCACAGGCCCCCAAGCTGCGGG - Intergenic
903770226 1:25759150-25759172 AGCTCATGCCATCAGCAGGCTGG + Intronic
905807389 1:40886736-40886758 ATCTCAGGGCACCTGGTGGCTGG - Intergenic
905866600 1:41380340-41380362 AGTTGAGGCCACCAGGTGGGAGG + Intronic
907189046 1:52633446-52633468 ACCTCGGGCCACCAGACGGCCGG - Exonic
911062299 1:93758902-93758924 TTCTCAGGCCATCAGGGGGCTGG + Intronic
912328082 1:108787902-108787924 ACCTCAGGCCCCCAAGCAGCTGG + Intronic
916950385 1:169774321-169774343 AGCTCAGCCCCCCAGGTAGCAGG + Intronic
919819360 1:201463216-201463238 AGAACTGGCCACCAGGCGCCAGG - Intergenic
919839397 1:201598042-201598064 AGCTTTGGCCACCTGGCGCCTGG - Intergenic
920200772 1:204258550-204258572 CGCTCAGGCCACTAGAGGGCAGG + Intronic
920654361 1:207864648-207864670 AACTCAGGCCTCCAGGCTCCAGG + Intergenic
920917936 1:210273002-210273024 AGCACAGGCCAGCTGGGGGCGGG + Intergenic
922734386 1:227971593-227971615 TGTACAGGCCACCGGGCGGCAGG - Intergenic
922734675 1:227972725-227972747 TGTACAGGCCACCGGGCGGCAGG - Intergenic
922922239 1:229315606-229315628 ACCTCAGCCCCCCAAGCGGCTGG - Intergenic
923042266 1:230327707-230327729 GGCTCAGCGCACCAGGCGCCAGG + Intronic
923215535 1:231845031-231845053 AGCTGAAGCCTCCAGGTGGCAGG + Intronic
923370234 1:233303398-233303420 TCCTCAGCCCACCAGGCAGCTGG - Intergenic
923688268 1:236169281-236169303 GGGTAAGGCCACCAGGTGGCAGG - Intronic
924557331 1:245129372-245129394 TGCAGAGCCCACCAGGCGGCAGG + Intergenic
1063230795 10:4063943-4063965 AGCTGAGGGCAGCAGGAGGCAGG - Intergenic
1063291373 10:4753427-4753449 AGCTCAGGCCACCTGGGGTGGGG + Intergenic
1063392611 10:5660115-5660137 AGCTCAGGCCTGCAGGCGGCAGG - Intronic
1067143889 10:43679708-43679730 AGCTCTGGTAACCAGGAGGCGGG + Intergenic
1067143902 10:43679766-43679788 AGCTCTGGTAACCAGGAGGCGGG + Intergenic
1067511012 10:46895201-46895223 AGCTCAGGAGACCAGGGGGGTGG - Intergenic
1069558654 10:69414289-69414311 TGCTCAGGCCACAAAGCGGCAGG - Intronic
1070850140 10:79556820-79556842 AGCTGAGGGGACCAGGAGGCAGG + Exonic
1070854387 10:79594900-79594922 AGCTAAGGGCACCAGGAAGCAGG + Intergenic
1070857082 10:79614480-79614502 AGCTGAGGGGACCAGGAGGCAGG - Exonic
1072420284 10:95285268-95285290 AGCTGAGGCCACAAGGCAACTGG + Intronic
1074266543 10:111909928-111909950 AGGTGAGGCCACCAGGTGGAAGG + Intergenic
1075571971 10:123552744-123552766 AGATGAGGCCACCAGGCTGTTGG + Intergenic
1076872994 10:133202677-133202699 AGTGCAGGCCAGGAGGCGGCAGG - Intronic
1076970399 11:129166-129188 TGTACAGGCCACCAGGAGGCAGG + Intergenic
1076997431 11:305111-305133 AGATGAGGCCTCCAGGTGGCAGG + Intergenic
1077283654 11:1756557-1756579 AGCTCAGGGCAGGAGGCCGCCGG + Intronic
1077331776 11:1987146-1987168 GGCTGAGGCCACCAGGCCACTGG - Intergenic
1077423848 11:2465384-2465406 ACCTAAGGCCACCTGGCTGCAGG - Intronic
1077430442 11:2513504-2513526 ACCTCAGGCCAGCAGGTGCCTGG - Intronic
1078394974 11:10973026-10973048 AGCTCAGGGCACCAGGAAGGAGG + Intergenic
1078402893 11:11044020-11044042 AACTCAGGGCACCAGGAGGAGGG + Intergenic
1078606911 11:12785123-12785145 GGCACAGGCCACCAGGAGCCCGG - Intronic
1084692931 11:70737418-70737440 AGGCCAGGCCACCTGGGGGCTGG - Intronic
1087098495 11:94342770-94342792 ATCTCAGCCCACCAGGTAGCTGG + Intergenic
1088526737 11:110763848-110763870 AGCTCAGGACACCTGGGGGAGGG - Intergenic
1089392928 11:118114390-118114412 AGCTGGGTCCACCAGGAGGCAGG + Intronic
1089578901 11:119469217-119469239 ATCTCAGCCCACCAAGCAGCTGG + Intergenic
1089879699 11:121762057-121762079 AGCTCAGGCTCCCAGGCTGCAGG + Intergenic
1202814757 11_KI270721v1_random:42322-42344 GGCTGAGGCCACCAGGCCACTGG - Intergenic
1091650616 12:2306340-2306362 ATCACAGGCCAGCAGGCAGCTGG + Intronic
1091678820 12:2511482-2511504 AGTTCAGGGCACGAGGCTGCTGG - Intronic
1091779190 12:3203156-3203178 AACTCCGGCCAGCAGGTGGCAGG - Intronic
1092261365 12:6954993-6955015 AGGTAAGGCAGCCAGGCGGCGGG + Exonic
1092462438 12:8698214-8698236 AGCGCGGGCCGCCGGGCGGCTGG - Exonic
1092618354 12:10235937-10235959 ACTTCTGGCCACCAGGTGGCAGG + Intergenic
1096641189 12:52995633-52995655 ACCTCAGCCCCCCAGGCAGCTGG - Intergenic
1096796724 12:54082539-54082561 AGCTCAGGCGGCCGTGCGGCGGG + Intergenic
1097170548 12:57110424-57110446 AGTTTAGGCCACCAAGCGGGCGG - Intronic
1100979756 12:100154928-100154950 GGCTCTGGCCACTAGGGGGCAGG + Intergenic
1101416962 12:104516781-104516803 AGCTCAGGGCACCAAGCAGAAGG + Intronic
1102247027 12:111362375-111362397 AGCTCAGGCCAGCCTGGGGCCGG + Exonic
1102700642 12:114836122-114836144 AGCTGAGAACACCAGGAGGCAGG + Intergenic
1104195754 12:126535961-126535983 AGCTCAGCCCAGCAGGCCACTGG + Intergenic
1105280613 13:18960611-18960633 AGGGCAGGCCACCAGGAGGATGG - Intergenic
1110804168 13:79735890-79735912 AGCTCAGGCCACCATTCAGGAGG - Intergenic
1113434967 13:110284053-110284075 AGGTCAGGCCACCAACGGGCAGG + Intronic
1113896583 13:113768479-113768501 AGCACAGGCCACCAGGGGTCCGG - Intronic
1114189594 14:20430311-20430333 AGCTCAGCCAAGCAGGCAGCTGG + Exonic
1120526583 14:85583873-85583895 AGCTCAGGCCCCCAAGTAGCTGG - Intronic
1121407706 14:93728980-93729002 AGGTCAGGCCAGCAAGGGGCAGG - Intronic
1122959200 14:105086927-105086949 AGCCGCAGCCACCAGGCGGCAGG - Intergenic
1123016485 14:105377982-105378004 ACCAACGGCCACCAGGCGGCAGG - Intronic
1123218256 14:106831935-106831957 AGCTCAGCCCAGCAGGCTTCAGG - Intergenic
1123579495 15:21703578-21703600 ATCTCAGGCCCCCAGGAGGGAGG - Intergenic
1123616122 15:22146089-22146111 ATCTCAGGCCCCCAGGAGGGAGG - Intergenic
1124055208 15:26235644-26235666 ATCTCAGGCGACCAGGGAGCCGG + Intergenic
1124483616 15:30098070-30098092 GGCTCTGGCCACCAGGGGGCAGG - Intergenic
1124490072 15:30150132-30150154 GGCTCTGGCCACCAGGGGGCAGG - Intergenic
1124519962 15:30399156-30399178 GGCTCTGGCCACCAGGGGGCAGG + Intergenic
1124538692 15:30567068-30567090 GGCTCTGGCCACCAGGGGGCAGG - Intergenic
1124645795 15:31436849-31436871 AGCTCAGGTCACCAGGCTTCAGG + Intergenic
1124753460 15:32388195-32388217 GGCTCTGGCCACCAGGGGGCAGG + Intergenic
1124759958 15:32440514-32440536 GGCTCTGGCCACCAGGGGGCAGG + Intergenic
1124831487 15:33153756-33153778 GGCTCATGGCTCCAGGCGGCAGG - Exonic
1124975202 15:34523898-34523920 GGCTCTGGCCACCAGGGGGCAGG + Intergenic
1125510773 15:40291315-40291337 AGCTCGGGCCACCGGGCGTGGGG - Exonic
1126387499 15:48109105-48109127 AGCCCAGGACACGAGGCGGGGGG + Intergenic
1127528959 15:59823180-59823202 ACCTCAGGCCAACAGCCAGCAGG - Intergenic
1127913843 15:63439590-63439612 AGCACAGAGCACCAGGAGGCAGG - Intergenic
1128812194 15:70580800-70580822 GGCTCAGGCCACCAGGAGCAGGG + Intergenic
1129109542 15:73329503-73329525 AGCACAGGCCACCAGCCAGTGGG - Intronic
1129210626 15:74065919-74065941 GGCTCTGGCCACTAGGGGGCAGG + Intergenic
1129403384 15:75299410-75299432 GGCTCTGGCCACTAGGGGGCAGG - Intergenic
1129727826 15:77910552-77910574 GGCTCTGGCCACTAGGGGGCAGG + Intergenic
1129743866 15:78004391-78004413 AGCTCAGGCTTCCAGGCAGGAGG + Intronic
1129840050 15:78738308-78738330 GGCTCTGGCCACTAGGGGGCAGG - Intergenic
1130282486 15:82530949-82530971 AGCTCCGGCCACTAGGGGTCAGG - Intergenic
1130303457 15:82697907-82697929 AGCTCAGGACACCAGGGGCATGG + Intronic
1130502071 15:84505749-84505771 AGCTCTGGCCACTAGGGGACAGG + Intergenic
1130540454 15:84817665-84817687 AGCCCAGGCCTCCAGGGGCCAGG - Intronic
1130890806 15:88132467-88132489 AGCCCAGGCCACCAGATGGGAGG + Intronic
1131189356 15:90301381-90301403 TGCTCTGGCCACTAGGGGGCAGG - Intronic
1131387370 15:92018577-92018599 AGGTCAGGCTGCCAGGAGGCTGG - Intronic
1132185153 15:99797369-99797391 GGCTCTGGCCACCAGGGGGCAGG - Intergenic
1132431835 15:101767186-101767208 GGCTCTGGCCACCAGGGGGCAGG + Intergenic
1202988365 15_KI270727v1_random:437823-437845 ATCTCAGGCCCCCAGGAGGGAGG - Intergenic
1132536462 16:483730-483752 AGATGAGGCCTCCAGGCAGCAGG - Intronic
1132746097 16:1436937-1436959 TGCACAGGCCTGCAGGCGGCTGG + Intronic
1134024350 16:10942556-10942578 GGCTCCGGCCGCCAGGGGGCGGG + Intergenic
1135490483 16:22905113-22905135 ACCACAGGCCTCCAGGCAGCCGG + Intronic
1135535145 16:23288039-23288061 ACCTCAGCCCACCAAGCAGCTGG - Intronic
1136052548 16:27662447-27662469 AGCTCAGACCAAAAGACGGCTGG + Intronic
1136525271 16:30825593-30825615 AGCTCTGGCCACAATGAGGCAGG + Intergenic
1137033089 16:35543532-35543554 AGCTCAGGCAGACAAGCGGCCGG - Intergenic
1137446749 16:48536605-48536627 AGCTGAAGCCACCAGGCAGGAGG + Intergenic
1138395806 16:56703795-56703817 ATCCCAGGCCACCAGGCAGCAGG - Intronic
1138575382 16:57904202-57904224 ACCTGAGGCCACCAAGGGGCTGG - Intronic
1138846458 16:60573110-60573132 AGCCCAGGAAACCAGGAGGCAGG - Intergenic
1139505086 16:67394628-67394650 AGCCCAGGGCGCCGGGCGGCCGG - Exonic
1141440922 16:84029129-84029151 AGCTTAGGCCTCCAGGCCTCAGG + Intronic
1141713343 16:85713023-85713045 AGCACCGTCAACCAGGCGGCTGG + Intronic
1141853561 16:86665227-86665249 AGCACTGGCCGCCAGGCAGCTGG + Intergenic
1142020300 16:87778033-87778055 AGGTCAGGGCAGCAGCCGGCCGG + Intergenic
1142449851 16:90168316-90168338 TGTACAGGCCACCAGGAGGCAGG - Intergenic
1142457236 17:63530-63552 TGTACAGGCCACCAGGAGGCAGG + Intergenic
1142600243 17:1050338-1050360 AGCTCAGGCCCCCAGACTCCAGG - Intronic
1143119866 17:4599906-4599928 GGCCCAGGCCACCGGGAGGCGGG - Intronic
1145984054 17:29032488-29032510 AGCTTAGGCAACCTGGCGGGTGG + Intronic
1146244161 17:31264016-31264038 AGCTCAGCCCATCATGCTGCTGG - Intronic
1146277678 17:31525548-31525570 GGCTCAGTCCACCAGGGGTCAGG - Intronic
1147267734 17:39244916-39244938 ACATCTGGCCACCAGGGGGCAGG - Intergenic
1148055984 17:44795985-44796007 AGCCCGGGCCGCCAAGCGGCCGG - Intergenic
1148472734 17:47905613-47905635 AGCCCTGGCCACCAGGCTGCAGG - Intronic
1148865961 17:50628694-50628716 AGCTGGGGGCACCAGGCTGCCGG + Intergenic
1150025562 17:61670417-61670439 GGCTCATGCCACCATGCGCCTGG - Intergenic
1151571110 17:74925780-74925802 AGCTCAGGATACGAGGCGGATGG - Intronic
1152730084 17:81965869-81965891 GGCACAGGGCACCAGGTGGCGGG + Intergenic
1154062105 18:11071788-11071810 AGCAGAGGCCTCCAGGAGGCCGG + Intronic
1155057873 18:22200823-22200845 AGCCCACGCCGCCAGGAGGCAGG + Exonic
1156330089 18:36113207-36113229 ACCTCAGCCTACCAGGCAGCTGG + Intronic
1160647595 19:200635-200657 TGTACAGGCCACCAGGAGGCAGG + Intergenic
1161052819 19:2173820-2173842 AGCTCAGCTCACCAGGCCTCTGG - Intronic
1161510026 19:4665075-4665097 ACCCCAGGCCACCAGGAGGGCGG - Intronic
1162145185 19:8608989-8609011 AGCCCAGGGCACCAGGTGGTGGG + Intronic
1162295051 19:9807672-9807694 AGCCCAGGACATCAGGGGGCTGG - Intergenic
1162369038 19:10268121-10268143 AGCTCAGGCCACAAGACAGGAGG + Intergenic
1162519514 19:11171330-11171352 ACCTCAGGCCACCAAGTAGCTGG - Intronic
1162795505 19:13085408-13085430 AGCTCAGGCTCCCAGGGGACTGG - Intronic
1163238849 19:16046448-16046470 TGCTCTGTCCCCCAGGCGGCTGG - Intergenic
1163337067 19:16680113-16680135 AGCTGAGGCCAGCAGGATGCTGG - Exonic
1164509102 19:28882964-28882986 AGCTAAGGTCACCAGGCTCCAGG + Intergenic
1165164625 19:33843132-33843154 AGCTCAGCCCACCATGGTGCTGG - Intergenic
1165363236 19:35349643-35349665 AGCTCTGGTCACCAGGCTTCAGG - Intergenic
1166382178 19:42360913-42360935 AGGTGAGGACAGCAGGCGGCAGG - Exonic
1167031801 19:46967174-46967196 AGGTCAGGCCACCAGGACTCTGG + Intronic
1167561858 19:50230871-50230893 AGCAGGAGCCACCAGGCGGCGGG - Intronic
925149171 2:1602855-1602877 AGGTCAGCCCACCAGGCCCCAGG + Intergenic
925159682 2:1675279-1675301 AGCACAGGTCACCAGGCCTCAGG + Intronic
925191822 2:1891360-1891382 CGCCGAGGCCACCAGGCGGCTGG - Intronic
926325208 2:11779355-11779377 TCCTCCGGCCACCAGGGGGCAGG - Intronic
927197384 2:20557970-20557992 AGCAGAGGGCACCAGGCTGCTGG + Intergenic
930326562 2:49927055-49927077 AGGTCAGGCCAGCAGGGGCCAGG + Intronic
930360093 2:50367021-50367043 AGCTGAGGCCTCCAGGCGTCTGG + Intronic
931403076 2:61949866-61949888 ATCTCAGGCCCCCAGGCCACTGG + Intronic
932494420 2:72139359-72139381 AGCTGAGGCAGCCAGGCAGCTGG - Intronic
934563532 2:95325332-95325354 AGCTCAGCCCAGCAGGAGGGCGG + Intronic
934567231 2:95347478-95347500 AGCCCAGGGCACCTGGCAGCCGG + Intronic
938743968 2:134259677-134259699 AGCTCAGGGAACCAGGAGACAGG - Intronic
939317905 2:140576769-140576791 AGCTCAGGCCAAAAGTCGACTGG - Intronic
940943926 2:159594744-159594766 AGCTCAGTCTCCCAAGCGGCTGG + Intronic
943488104 2:188514153-188514175 AGCTCAGGGTCCCAGGTGGCAGG - Intronic
943783188 2:191847024-191847046 AGCTCAGGGCACCAGTCTCCAGG + Exonic
946015033 2:216597149-216597171 AGCTCAGGCCACCAGAGATCTGG + Intergenic
946180983 2:217948743-217948765 AACTCAGGCCAGAAGGAGGCAGG + Intronic
948118962 2:235514678-235514700 TGCACAGGCCACCAGGTGGCAGG - Intronic
948315843 2:237027611-237027633 AGCTGAGTCCACCTGGTGGCCGG + Intergenic
948369895 2:237482158-237482180 AGCTCAGGCCACCTGGATGGTGG + Intergenic
948410076 2:237752518-237752540 AGCAGAGGCTACCAGGGGGCTGG - Intronic
1169049206 20:2562004-2562026 AGCTCAGGTGAGCAGGCTGCGGG + Exonic
1169143335 20:3238152-3238174 GGCTCTGGCTTCCAGGCGGCCGG - Exonic
1172113207 20:32559648-32559670 AACCCAGGCCCCCAGGCGCCAGG + Intronic
1175648584 20:60696940-60696962 AGATAAGGCCTCCAGGCAGCAGG + Intergenic
1175800837 20:61800270-61800292 AGCTCTGCCCCCCTGGCGGCCGG - Intronic
1176100621 20:63362838-63362860 ATCTGAGGCCAGCAGGAGGCCGG - Intronic
1177212371 21:18087101-18087123 AGCTGAGGCCACCACCCAGCTGG - Intronic
1177421128 21:20859204-20859226 AGCTCAGGCCAACTGGGGGCGGG - Intergenic
1179112330 21:38458095-38458117 AGCTCAGTGCTCCAGTCGGCTGG - Intronic
1181144452 22:20834411-20834433 AGCTCAGCCCACAATGCTGCAGG + Intronic
1181427861 22:22855862-22855884 CTCTGAGGCCACCAGGGGGCGGG + Intronic
1182437640 22:30340947-30340969 AGCTGAGGCCAGCCGGCAGCAGG + Intronic
1183161586 22:36117191-36117213 AGCTCAGGCCCACAGGCCCCTGG - Intergenic
1183604529 22:38860743-38860765 CGCTCAGGACCCCAGGCTGCAGG + Intergenic
1184045662 22:41970974-41970996 AGCTCAGGTGTCCAGGTGGCAGG - Intergenic
1184238599 22:43199869-43199891 AGGTGAGGCCACCTGGCTGCAGG + Exonic
1184437258 22:44486711-44486733 AGCTCAGGGCATCAGCAGGCTGG + Intergenic
1184836012 22:47021448-47021470 TGCTCAGGGCTCCAGGCGACAGG - Intronic
950423611 3:12912905-12912927 AGCTCAGGGCTCCAGGAGGTGGG + Intronic
951350493 3:21601775-21601797 AGCTCAAGCTTCCAGGGGGCGGG - Intronic
953644266 3:44739530-44739552 AGGGCAGGCCAGCAGGCTGCAGG - Intronic
953703638 3:45215255-45215277 TGCTGAGGCCACCAGCAGGCTGG - Intergenic
954128740 3:48548911-48548933 TTCTCTGGCCACCAGGGGGCAGG - Intronic
954615249 3:51966212-51966234 GGCCCAGGCCACGAGGAGGCTGG - Intronic
955060552 3:55488703-55488725 AGCGCAGACAACCAGGCGGCAGG - Intronic
955687404 3:61561462-61561484 AGCCCGGGCCAGCTGGCGGCGGG - Intergenic
960865667 3:122197176-122197198 AGCTCAGCCCACCAGGTTGGTGG - Intronic
960989838 3:123303278-123303300 AGCCCAGCCCACCAGGCCGCAGG + Intronic
961410180 3:126714674-126714696 AGCTCAGGCCTACAGCAGGCAGG - Intronic
962811615 3:138963283-138963305 TGCTCAGGGCTGCAGGCGGCTGG - Intergenic
963230964 3:142908587-142908609 ACCTCAGGCCACAAGGCGGGTGG + Intergenic
964359715 3:155881951-155881973 AGCTCAGTCTCCCAGGTGGCTGG - Intronic
966711920 3:182980438-182980460 AGCGCCGGCCCCCAGCCGGCAGG + Intronic
967910323 3:194537405-194537427 GGGTCAGGCCACCAGGCCCCAGG - Intergenic
968370252 3:198219480-198219502 TGTACAGGCCACCAGGAGGCAGG - Intergenic
968509753 4:990377-990399 CGGTCAGGCCAGCAGGCGCCTGG + Intronic
968625096 4:1623434-1623456 GTCTCAGGCCACCAGGCCCCCGG + Intronic
968813734 4:2811333-2811355 AGCACAGGCCACAAAGCTGCAGG - Intronic
969713709 4:8858614-8858636 AGCGCAGGCCCCCGGGCGGCCGG + Intronic
969843505 4:9901137-9901159 AGCTCAGGCCCCCAGGGGTTTGG + Intronic
970860758 4:20700322-20700344 TGCCCAGGCAACCAGGCGCCAGG - Intronic
973706940 4:53590425-53590447 AGCTCATCCCAGCAGGCAGCTGG + Intronic
980861097 4:138500267-138500289 AGCCCTGGCCACCAGGCACCTGG - Intergenic
982232608 4:153222908-153222930 AGCTCACGACATCAGGCAGCGGG - Intronic
983088313 4:163473829-163473851 AGCTCAGGCCTTCAGGCAGAGGG - Intergenic
986691155 5:10315041-10315063 AGTGCAGGGCAGCAGGCGGCAGG - Intergenic
989212012 5:38865975-38865997 TGCTCAGGCTTCCAGGAGGCAGG + Intronic
989570738 5:42943993-42944015 AGCTCAGGGCTGGAGGCGGCTGG - Intergenic
990754736 5:59056204-59056226 AGCTCATGGCACTAGGCTGCAGG + Intronic
995012674 5:107275551-107275573 AGGGCAGGCCACGAGGCTGCAGG + Intergenic
995485558 5:112636756-112636778 AGCTCAGGCCAAAAGGTGTCAGG + Intergenic
999448537 5:151660764-151660786 AGCTCAGGGCCCCGGGCGGGAGG - Intergenic
1002001144 5:176196875-176196897 TGCTGAGGCCATCAGGCCGCAGG - Intergenic
1002087100 5:176782787-176782809 TGCTGAGGCCACCACGGGGCAGG + Intergenic
1002253191 5:177942097-177942119 TGCTGAGGCCATCAGGCCGCAGG + Intergenic
1002729779 5:181326238-181326260 TGTACAGGCCACCAGGAGGCAGG - Intergenic
1002771168 6:292085-292107 GGCTCGGGCTCCCAGGCGGCCGG - Intronic
1004839458 6:19566347-19566369 AGTTCAGGCAACCATGCAGCAGG + Intergenic
1005682424 6:28219617-28219639 ACCTCAGGCCCCCAGGTAGCTGG - Intergenic
1008535605 6:52504343-52504365 AGCCCTGGCCACCACGGGGCAGG - Intronic
1011801596 6:91022134-91022156 AGCCCAGGCCATCAAGCTGCCGG + Intergenic
1016773139 6:147874525-147874547 AGCTCCTGCCACCAGCTGGCCGG - Intergenic
1017817841 6:158028111-158028133 AGCTCAGGAGAGCAGCCGGCTGG + Intronic
1018457011 6:163961917-163961939 AGCCAAGGCCACCAGGCTGGAGG - Intergenic
1018915914 6:168132244-168132266 AGTTCAGGTCACCTGGCTGCTGG + Intergenic
1018999808 6:168740674-168740696 GGCTCAGGCCAGCAGGAGCCTGG + Intergenic
1019390874 7:786580-786602 CGCTCTGGACACCAGGGGGCAGG + Intergenic
1020175308 7:5877351-5877373 AGCTCAGCCTCCCAGGAGGCTGG - Intergenic
1021877315 7:25060691-25060713 GGCTCAGGCCACCAGGAGAATGG + Intergenic
1023017827 7:35984197-35984219 ACCTCAGGGCACCAGGCCCCAGG + Intergenic
1024722115 7:52148949-52148971 AGATGAGGCCTCCAGGTGGCAGG - Intergenic
1025829758 7:65038645-65038667 AGCTCAGGCCTGGGGGCGGCGGG + Intergenic
1025917013 7:65873645-65873667 AGCTCAGGCCTGGGGGCGGCGGG + Intronic
1026852760 7:73735405-73735427 AGCCCAGAGTACCAGGCGGCTGG + Intergenic
1026888907 7:73970920-73970942 AGCCCTGGCCCACAGGCGGCTGG - Intergenic
1028121314 7:87059373-87059395 AGCCCAGGCCGCCTGGCAGCCGG + Exonic
1029083471 7:97993273-97993295 AGCTCAGCCTCCCAGGAGGCTGG + Intergenic
1029119807 7:98259887-98259909 AGATCAGGCCACCACGCTCCAGG - Intronic
1032051495 7:128653359-128653381 TGTACAGGCCACCAGGAGGCAGG - Intergenic
1032427400 7:131832866-131832888 AGACCAGGACACCAGGAGGCAGG + Intergenic
1037769172 8:21789006-21789028 CGCTCGGGCTCCCAGGCGGCTGG + Intronic
1037893531 8:22636784-22636806 AGCTCAGGTCACCAGGCTGCTGG - Intronic
1037904012 8:22704779-22704801 ATCTCAGGCCACCTGGTGGCAGG - Intergenic
1045048902 8:98305111-98305133 AGCTCAAGCCATCAGGCAGCAGG + Intergenic
1048330944 8:133470570-133470592 AGCTCAGGCCACCAGGCGGCAGG - Intronic
1049593136 8:143471621-143471643 AGCTCAGGCCTTCAGGTGGCAGG + Intronic
1049991593 9:996705-996727 AGCTCAGGCCACCAGCAACCAGG + Intergenic
1051904614 9:22080775-22080797 ACCACAGGCCACCAGACTGCTGG + Intergenic
1053786323 9:41655204-41655226 AGCTCAGGCGGCCGCGCGGCAGG + Intergenic
1054560032 9:66699676-66699698 AGCTCAAACCACCAGGCAGGAGG - Intergenic
1056205450 9:84315452-84315474 AGATCCTGCCACCAGGTGGCAGG - Intronic
1056311296 9:85343555-85343577 AGCTGAGTCCAGCAGGCAGCAGG - Intergenic
1057185136 9:93053206-93053228 ACCTGAGGCCACCAGAGGGCTGG + Intergenic
1057272284 9:93657952-93657974 AGGGCAGGCCACCAGGAGGATGG + Intronic
1057825684 9:98370580-98370602 AGCTCAGGCCTGCAGCAGGCCGG - Intronic
1059311355 9:113390835-113390857 ATCACAGGCCACCAGGAGGTTGG + Exonic
1060544882 9:124453832-124453854 AGCGCAGACCCCCAGGCTGCTGG - Intronic
1061062060 9:128255406-128255428 GGCTCTGGCCACTAGGGGGCAGG + Intergenic
1061238529 9:129355993-129356015 AGCTCAGGGCTCCAAGAGGCAGG + Intergenic
1061860665 9:133467184-133467206 AGCGCTGGCCTCCAGGCTGCAGG + Intronic
1062290479 9:135792177-135792199 AGCTCAGGCCACCAAGCCCGGGG + Exonic
1062754191 9:138278750-138278772 TGTACAGGCCACCAGGAGGCAGG - Intergenic
1203577751 Un_KI270745v1:21507-21529 TGTACAGGCCACCAGGAGGCAGG - Intergenic
1193134939 X:77960235-77960257 AGCACATGCCACCAGGCCCCAGG - Intronic
1194662771 X:96645064-96645086 AGGTCAGGCCACCAACTGGCAGG - Intergenic
1196046331 X:111260081-111260103 AGCTGAGGCCAATAGACGGCTGG + Intronic
1199614984 X:149649140-149649162 AGCCAGGGCCACCAGGTGGCAGG - Intergenic
1200162515 X:154016775-154016797 AGCAGAGGCCCCCAGGCAGCTGG - Intronic
1200234239 X:154460500-154460522 GCCGCAGGCCACCAGGCGGCGGG - Exonic
1200732060 Y:6753078-6753100 AGCTCATGCCACCAGGCCTGTGG - Intergenic
1202367747 Y:24178574-24178596 AGCTCTGGCCACTAGGGGACAGG - Intergenic
1202503036 Y:25491549-25491571 AGCTCTGGCCACTAGGGGACAGG + Intergenic